NH024b, NH024b (genetic_marker) Pyrus pyrifolia | GDR

Marker Overview

Marker Overview


Name	NH024b
Genbank ID	N/A
Type	SSR
Species	Pyrus pyrifolia
Repeat Motif	(AG)30
Primer 1	NH024b.forward primer: accaaaagtagagagagaga
Primer 2	NH024b.reverse primer: cccaaccagactaaaagaga
Publication	[view all]
Contact	Toshiya Yamamoto

Contact

Name

Details

Toshiya Yamamoto

First name:	Toshiya
Last name:	Yamamoto
Institution:	National Institute of Fruit Tree Science, Graduate School of Life and Environmental Sciences, University of Tsukuba
Address:	National Institute of Fruit Tree Science, 2-1 Fujimoto, Tsukuba, Ibaraki 305-8605, Japan
Country:	Japan
Email:	toshiya@affrc.go.jp
Last update:	Apr 2014

Publications


Year	Publication
2002	Yamamoto T, Kimura T, Shoda M, Imai T, Saito T, Sawamura Y, Kotobuki K, Hayashi T, Matsuta N. Genetic linkage maps constructed by using an interspecific cross between Japanese and European pears. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2002 Dec; 106(1):9-18.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Pear-BD-F1-2015	LG3	N/A	86.8	NH024b	View
2	Pear-Bayuehong-F1-2015	LG3	N/A	87.64	NH024b	View
3	Pear-Dangshansuli-F1-2015	LG3	N/A	88.11	NH024b	View
4	Pear-integrated_consensus_map-IPCG-2017	LG3	N/A	209.82	NH024b	View
5	Pear-integrated_consensus_map-IPCG-2017	LG11	N/A	150.1	NH024b	View
6	Pear-Rcf-F1-female	LG3	N/A	95.91	NH024b	View
7	Pear-M-F1-male	LG3	N/A	145.57	NH024b	View
8	Pear-RM-F1-Integrated	LG3	N/A	122.63	NH024b	View