TXY2, TXY2 (genetic_marker) Pyrus spp.

Marker Overview
NameTXY2
Genbank IDKC770001
TypeSSR
SpeciesPyrus spp.
Repeat Motif(AC)9
Primer 1TXY2.Tail primer:
Primer 2TXY2.forward primer: F:ACGCTTCAGGTTTGGACTTC
Primer 3TXY2.reverse primer: TCAACCTGGACCATACATTCA
Product Length184-202
Publication[view all]
ContactDan-ying Cai
Yuan-wen Teng
Commentputative function: No significant match
Contact
NameDetails
Dan-ying Cai
First name:Dan-ying
Last name:Cai
Address:State Agricultural Ministry Key Laboratory of Horticultural Plant Growth, Development & Quality Improvement, Department of Horticulture, Zhejiang University, Hangzhou 310058, China
Country:China
Email:dycai@zju.edu.ch
Yuan-wen Teng
First name:Yuan-wen
Last name:Teng
Address:State Agricultural Ministry Key Laboratory of Horticultural Plant Growth, Development & Quality Improvement, Department of Horticulture, Zhejiang University, Hangzhou 310058, China
Country:China
Email:ywteng@zju.edu.cn
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Tail primerTXY2.Tail primerPyrus spp.primer
forward primerTXY2.forward primerPyrus spp.primer
reverse primerTXY2.reverse primerPyrus spp.primer