TXY4, TXY4 (genetic_marker) Pyrus spp.

Marker Overview
NameTXY4
Genbank IDKC770002
TypeSSR
SpeciesPyrus spp.
Repeat Motif(AC)9
Primer 1TXY4.Tail primer:
Primer 2TXY4.forward primer: F:AGTTCCGATGACAAACCAGC
Primer 3TXY4.reverse primer: GCCAACTCCTCTGTTTCTTCTC
Product Length251-271
Publication[view all]
ContactDan-ying Cai
Yuan-wen Teng
Commentputative function: bZIP transcription factor bZIP90
Contact
NameDetails
Dan-ying Cai
First name:Dan-ying
Last name:Cai
Address:State Agricultural Ministry Key Laboratory of Horticultural Plant Growth, Development & Quality Improvement, Department of Horticulture, Zhejiang University, Hangzhou 310058, China
Country:China
Email:dycai@zju.edu.ch
Yuan-wen Teng
First name:Yuan-wen
Last name:Teng
Address:State Agricultural Ministry Key Laboratory of Horticultural Plant Growth, Development & Quality Improvement, Department of Horticulture, Zhejiang University, Hangzhou 310058, China
Country:China
Email:ywteng@zju.edu.cn
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Tail primerTXY4.Tail primerPyrus spp.primer
forward primerTXY4.forward primerPyrus spp.primer
reverse primerTXY4.reverse primerPyrus spp.primer