TXY5, TXY5 (genetic_marker) Pyrus spp.

Marker Overview
NameTXY5
Genbank IDKC770003
TypeSSR
SpeciesPyrus spp.
Repeat Motif(TG)8
Primer 1TXY5.Tail primer:
Primer 2TXY5.forward primer: F:GGAGCAATGTGTGTTGTCACT
Primer 3TXY5.reverse primer: CCTTGCGATCGATAATTTCC
Product Length132-142
Publication[view all]
ContactDan-ying Cai
Yuan-wen Teng
Commentputative function: No significant match
Contact
NameDetails
Dan-ying Cai
First name:Dan-ying
Last name:Cai
Address:State Agricultural Ministry Key Laboratory of Horticultural Plant Growth, Development & Quality Improvement, Department of Horticulture, Zhejiang University, Hangzhou 310058, China
Country:China
Email:dycai@zju.edu.ch
Yuan-wen Teng
First name:Yuan-wen
Last name:Teng
Address:State Agricultural Ministry Key Laboratory of Horticultural Plant Growth, Development & Quality Improvement, Department of Horticulture, Zhejiang University, Hangzhou 310058, China
Country:China
Email:ywteng@zju.edu.cn
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Tail primerTXY5.Tail primerPyrus spp.primer
forward primerTXY5.forward primerPyrus spp.primer
reverse primerTXY5.reverse primerPyrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TXY5TXY5-66.731Pyrus spp.marker_locus
TXY5TXY5-102.545Pyrus spp.marker_locus
TXY5TXY5-101.953Pyrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pear-Rcf-F1-femaleLG16N/A66.73TXY5View
2Pear-M-F1-maleLG16N/A102.55TXY5View
3Pear-RM-F1-IntegratedLG16N/A101.95TXY5View