TXY16, TXY16 (genetic_marker) Pyrus spp.

Marker Overview
NameTXY16
Genbank IDKC770008
TypeSSR
SpeciesPyrus spp.
Repeat Motif(TC)8
Primer 1TXY16.Tail primer:
Primer 2TXY16.forward primer: F:TTGCTGAAGCTTCTCTTCTTCTC
Primer 3TXY16.reverse primer: GAGCCCACAAGGGTTCAATA
Product Length164-172
Publication[view all]
ContactDan-ying Cai
Yuan-wen Teng
Commentputative function: CLE26 protein / CLAVATA3/ESR (CLE)-related protein
Contact
NameDetails
Dan-ying Cai
First name:Dan-ying
Last name:Cai
Address:State Agricultural Ministry Key Laboratory of Horticultural Plant Growth, Development & Quality Improvement, Department of Horticulture, Zhejiang University, Hangzhou 310058, China
Country:China
Email:dycai@zju.edu.ch
Yuan-wen Teng
First name:Yuan-wen
Last name:Teng
Address:State Agricultural Ministry Key Laboratory of Horticultural Plant Growth, Development & Quality Improvement, Department of Horticulture, Zhejiang University, Hangzhou 310058, China
Country:China
Email:ywteng@zju.edu.cn
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Tail primerTXY16.Tail primerPyrus spp.primer
forward primerTXY16.forward primerPyrus spp.primer
reverse primerTXY16.reverse primerPyrus spp.primer