TXY185, TXY185 (genetic_marker) Pyrus spp. | GDR

Marker Overview

Marker Overview


Name	TXY185
Genbank ID	KC770070
Type	SSR
Species	Pyrus spp.
Repeat Motif	(CAG)7
Primer 1	TXY185.Tail primer:
Primer 2	TXY185.forward primer: F:GGAGGACCAACAGCAACATT
Primer 3	TXY185.reverse primer: AGCAAGATCAAGCCAGGTGT
Product Length	184-190
Publication	[view all]
Contact	Dan-ying Cai Yuan-wen Teng
Comment	putative function: Growth-regulating factor 5 / Uncharacterized protein DDB_G0271670

Contact

Name

Details

Dan-ying Cai

First name:	Dan-ying
Last name:	Cai
Address:	State Agricultural Ministry Key Laboratory of Horticultural Plant Growth, Development & Quality Improvement, Department of Horticulture, Zhejiang University, Hangzhou 310058, China
Country:	China
Email:	dycai@zju.edu.ch

Yuan-wen Teng

First name:	Yuan-wen
Last name:	Teng
Address:	State Agricultural Ministry Key Laboratory of Horticultural Plant Growth, Development & Quality Improvement, Department of Horticulture, Zhejiang University, Hangzhou 310058, China
Country:	China
Email:	ywteng@zju.edu.cn

Publications


Year	Publication
2014	Yue XY, Liu GQ, Zong Y, Teng YW, Cai DY. Development of genic SSR markers from transcriptome sequencing of pear buds. Journal of Zhejiang University. Science. B. 2014 Apr; 15(4):303-12.