NH203a, NH203a (genetic_marker) Pyrus pyrifolia | GDR

Marker Overview

Marker Overview


Name	NH203a
Genbank ID	N/A
Type	SSR
Species	Pyrus pyrifolia
Repeat Motif	(AC)7.5
Primer 1	NH203a.forward primer: TCGATACTCCACAAGACTGCTC
Primer 2	NH203a.reverse primer: GTTTCTTCCACCTCCAAGCTCAAGTTTC
Publication	[view all]
Contact	Yutaka Sawamura

Contact

Name

Details

Yutaka Sawamura

First name:	Yutaka
Last name:	Sawamura
Institution:	Institute of Fruit Tree and Tea Science
Address:	Institute of Fruit Tree and Tea Science, NARO, Tsukuba 305-8605, Japan
Country:	Japan
Email:	ysawa@affrc.go.jp

Publications


Year	Publication
2004	Sawamura Y, Saito T, Takada N, Yamamoto T, Kimura T, Hayashi T,, Kotobuki K. Identification of Parentage of Japanese Pear 'Housui'. Journal of the Japanese Society for Horticultural Science 2004 73(6):511-518

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Pear-Ba-F1-2013	Ba3	N/A	28.7	NH203a	View
2	Pear-BD-F1-2015	LG3	N/A	58.4	NH203a	View
3	Pear-Bayuehong-F1-2015	LG3	N/A	58.58	NH203a	View
4	Pear-Dangshansuli-F1-2015	LG3	N/A	58.66	NH203a	View
5	Pear-integrated_consensus_map-IPCG-2017	LG3	N/A	175.43	NH203a	View
6	Pear-Rcf-F1-female	LG3	N/A	62.12	NH203a	View
7	Pear-M-F1-male	LG3	N/A	89.81	NH203a	View
8	Pear-RM-F1-Integrated	LG3	N/A	77.85	NH203a	View
9	Apple-JM7xS63-F1	S3	N/A	36.6	NH203a	View
10	Pear-Bartlett-F1-2007	Ba3	N/A	31.8	NH203a	View
11	Pear-La_France-F1-2007	La3	N/A	26.1	NH203a	View