AX-89812810, AX-89812810 (genetic_marker) Fragaria x ananassa

Marker Overview
NameAX-89812810
dbSNP IDN/A
SNP Array ID
90K SNP array for cultivated strawberry:Affx-88820741
TypeSNP
SNP AllelesA/C
Probe 1AX-89812810.AX-89812810: AGGACCGTATGTTAAAATGGCGTCACTAGG
5' Flanking SequenceCAGATTCCTGGCATACAATTTTACCGCAGTGATCC
3' Flanking SequenceTCTATGGAAGGAAGGGACTGTGTGAAAGTGATTCG
SpeciesFragaria x ananassa
Publication[view all]
ContactNahla Bassil
CommentCodon-based SNP
Contact
NameDetails
Nahla Bassil
First name:Nahla
Last name:Bassil
Title:Geneticist
Institution:USDA-ARS, NCGR, Corvallis, OR, USA
Address:USDA-ARS, NCGR, Corvallis, OR, USA
Country:USA
Email:nahla.bassil@ars.usda.gov
Phone:(541) 738-4214
Libraries
Library NameType
90K SNP array for cultivated strawberrySNP_chip
Sequence
>AX-89812810 ID=AX-89812810; Name=AX-89812810; organism=Fragaria x ananassa; type=genetic_marker; length=71bp
CAGATTCCTGGCATACAATTTTACCGCAGTGATCCMTCTATGGAAGGAAG
GGACTGTGTGAAAGTGATTCG
Alignments
Feature NameTypeLocationAnalysis
Fvb2 chromosome Fvb2:13206548..13206618+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb2-2 chromosome Fvb2-2:11003098..11003168- Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
LG2 chromosome LG2:3084769..3084769. Fragaria vesca Whole Genome v1.1 Assembly & Annotation