AX-89869802, AX-89869802 (genetic_marker) Fragaria x ananassa

Marker Overview
NameAX-89869802
dbSNP IDN/A
SNP Array ID
90K SNP array for cultivated strawberry:Affx-88820744
TypeSNP
SNP AllelesA/G
Probe 1AX-89869802.AX-89869802: GACGTTTCGGTTCGCCCAAAGCCGTTTCGA
5' Flanking SequenceCATTTGCATTTCCGGTGGCACTCACAACTGCTGCC
3' Flanking SequenceAGCTTTGCCGAAACCCGCTTGGCTTTGCAGTGGAG
SpeciesFragaria x ananassa
Publication[view all]
ContactNahla Bassil
CommentCodon-based SNP
Contact
NameDetails
Nahla Bassil
First name:Nahla
Last name:Bassil
Title:Geneticist
Institution:USDA-ARS, NCGR, Corvallis, OR, USA
Address:USDA-ARS, NCGR, Corvallis, OR, USA
Country:USA
Email:nahla.bassil@ars.usda.gov
Phone:(541) 738-4214
Libraries
Library NameType
90K SNP array for cultivated strawberrySNP_chip
Sequence
>AX-89869802 ID=AX-89869802; Name=AX-89869802; organism=Fragaria x ananassa; type=genetic_marker; length=71bp
CATTTGCATTTCCGGTGGCACTCACAACTGCTGCCRAGCTTTGCCGAAAC
CCGCTTGGCTTTGCAGTGGAG
Alignments
Feature NameTypeLocationAnalysis
Fvb2 chromosome Fvb2:13211833..13211903+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb2 chromosome Fvb2:3438421..3438491- Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb2-2 chromosome Fvb2-2:10997503..10997573- Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
Fvb2-1 chromosome Fvb2-1:6788633..6788703- Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
LG2 chromosome LG2:3090054..3090054. Fragaria vesca Whole Genome v1.1 Assembly & Annotation