AX-89812591, AX-89812591 (genetic_marker) Fragaria x ananassa

Marker Overview
NameAX-89812591
dbSNP IDN/A
SNP Array ID
90K SNP array for cultivated strawberry:Affx-88825219
TypeSNP
SNP AllelesA/C
Probe 1AX-89812591.AX-89812591: TAATCGGATAGAAGTACTTCTAAGATTAGG
5' Flanking SequenceAGAGGATTAGCCTATCTTCATGAAGATTCTAATCC
3' Flanking SequenceCGTGTTATTCACCGAGATTTTAAGGCTAGTAATGT
SpeciesFragaria x ananassa
Publication[view all]
ContactNahla Bassil
CommentCodon-based SNP
Contact
NameDetails
Nahla Bassil
First name:Nahla
Last name:Bassil
Title:Geneticist
Institution:USDA-ARS, NCGR, Corvallis, OR, USA
Address:USDA-ARS, NCGR, Corvallis, OR, USA
Country:USA
Email:nahla.bassil@ars.usda.gov
Phone:(541) 738-4214
Libraries
Library NameType
90K SNP array for cultivated strawberrySNP_chip
Sequence
>AX-89812591 ID=AX-89812591; Name=AX-89812591; organism=Fragaria x ananassa; type=genetic_marker; length=71bp
AGAGGATTAGCCTATCTTCATGAAGATTCTAATCCMCGTGTTATTCACCG
AGATTTTAAGGCTAGTAATGT