AX-89850782, AX-89850782 (genetic_marker) Fragaria x ananassa

Marker Overview
NameAX-89850782
dbSNP IDN/A
SNP Array ID
90K SNP array for cultivated strawberry:Affx-88892605
TypeSNP
SNP AllelesT/G
Probe 1AX-89850782.AX-89850782: CCCTTACTCTGCCTATCCGTCCGTGACGAT
5' Flanking SequenceCCGAGGGGAATGAGACGGATAGGCAGGCACTGCTA
3' Flanking SequenceCAATCAAAGATCAAATACAACACGATCCGAACCAG
SpeciesFragaria x ananassa
Publication[view all]
ContactNahla Bassil
CommentSNP-SNP (haploSNP)
Contact
NameDetails
Nahla Bassil
First name:Nahla
Last name:Bassil
Title:Geneticist
Institution:USDA-ARS, NCGR, Corvallis, OR, USA
Address:USDA-ARS, NCGR, Corvallis, OR, USA
Country:USA
Email:nahla.bassil@ars.usda.gov
Phone:(541) 738-4214
Libraries
Library NameType
90K SNP array for cultivated strawberrySNP_chip
Alignments
The following features are aligned
Feature Name Type LocationAnalysisReference
Fvb7chromosomeFvb7:6012089..6012151 +Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotationn/a
Fvb7chromosomeFvb7:12397507..12397560 +Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotationn/a
Fvb7chromosomeFvb7:12328784..12328854 -Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotationn/a
Fvb7chromosomeFvb7:12340581..12340648 -Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotationn/a
Fvb7chromosomeFvb7:12335584..12335651 -Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotationn/a
Fvb7chromosomeFvb7:12349063..12349129 -Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotationn/a
Fvb7chromosomeFvb7:12308538..12308604 -Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotationn/a
Fvb7-4chromosomeFvb7-4:11219850..11219916 +Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1n/a
Fvb7-3chromosomeFvb7-3:11700174..11700241 +Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1n/a
Fvb7-3chromosomeFvb7-3:11743373..11743436 +Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1n/a
Fvb7-3chromosomeFvb7-3:11659390..11659451 +Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1n/a
Fvb7-3chromosomeFvb7-3:11646671..11646737 +Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1n/a
Fvb7-3chromosomeFvb7-3:19222174..19222206 +Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1n/a
Fvb7-2chromosomeFvb7-2:11710480..11710533 +Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1n/a
Fvb7-2chromosomeFvb7-2:18269271..18269324 +Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1n/a
Fvb7-1chromosomeFvb7-1:6070360..6070422 +Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1n/a
Fvb7-4chromosomeFvb7-4:17109209..17109271 -Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1n/a
Fvb7-3chromosomeFvb7-3:19197640..19197699 -Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1n/a
Fvb7-2chromosomeFvb7-2:18193193..18193263 -Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1n/a
Fvb7-2chromosomeFvb7-2:18204460..18204527 -Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1n/a
Fvb7-2chromosomeFvb7-2:18199465..18199532 -Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1n/a
Fvb7-2chromosomeFvb7-2:18216348..18216414 -Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1n/a
Fvb7-2chromosomeFvb7-2:11662738..11662804 -Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1n/a
Fvb7-2chromosomeFvb7-2:18162745..18162811 -Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1n/a
Fvb7-1chromosomeFvb7-1:18761705..18761771 -Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1n/a
Fvb7-1chromosomeFvb7-1:17454737..17454800 -Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1n/a
LG7chromosomeLG7:3164871..3164871 .Fragaria vesca Whole Genome v1.1 Assembly & Annotationn/a
Sequence
>AX-89850782 ID=AX-89850782; Name=AX-89850782; organism=Fragaria x ananassa; type=genetic_marker; length=71bp
CCGAGGGGAATGAGACGGATAGGCAGGCACTGCTAKCAATCAAAGATCAA
ATACAACACGATCCGAACCAG