AX-89850864, AX-89850864 (genetic_marker) Fragaria x ananassa

Marker Overview
NameAX-89850864
dbSNP IDN/A
SNP Array ID
90K SNP array for cultivated strawberry:Affx-88893856
850K SNP array for cultivated strawberry:Affx-88893856
TypeSNP
SNP AllelesA/C
Probe 1AX-89850864.AX-89850864: AGTGTCAGACCATGAACGAGAATCTTAATA
5' Flanking SequenceTAGGATCACAGTCTGGTACTTGCTCTTAGAATTAT
3' Flanking SequenceATTTGCCCTGGAAAATGTCATGTTTCATATAACAA
SpeciesFragaria x ananassa
Publication[view all]
ContactNahla Bassil
CommentSNP-SNP (haploSNP)
Contact
NameDetails
Nahla Bassil
First name:Nahla
Last name:Bassil
Title:Geneticist
Institution:USDA-ARS, NCGR, Corvallis, OR, USA
Address:USDA-ARS, NCGR, Corvallis, OR, USA
Country:USA
Email:nahla.bassil@ars.usda.gov
Phone:(541) 738-4214
Sequence
>AX-89850864 ID=AX-89850864; Name=AX-89850864; organism=Fragaria x ananassa; type=genetic_marker; length=71bp
TAGGATCACAGTCTGGTACTTGCTCTTAGAATTATMATTTGCCCTGGAAA
ATGTCATGTTTCATATAACAA
Alignments
Feature NameTypeLocationAnalysis
Fvb7 chromosome Fvb7:1016829..1016899+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb7-2 chromosome Fvb7-2:967810..967880+ Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
Fvb7-1 chromosome Fvb7-1:656176..656246+ Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
Fvb2-3 chromosome Fvb2-3:23841722..23841792+ Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
Fvb7-4 chromosome Fvb7-4:21459095..21459165- Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
Fvb7-3 chromosome Fvb7-3:23996969..23997039- Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
Fvb2-3 chromosome Fvb2-3:23861648..23861718- Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
Fvb2-3 chromosome Fvb2-3:23852022..23852092- Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
LG7 chromosome LG7:6119531..6119531. Fragaria vesca Whole Genome v1.1 Assembly & Annotation
Fvb7-2 chromosome Fvb7-2:967845..967845. Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1