AX-89850877, AX-89850877 (genetic_marker) Fragaria x ananassa

Marker Overview
NameAX-89850877
dbSNP IDN/A
SNP Array ID
90K SNP array for cultivated strawberry:Affx-88893949
TypeSNP
SNP AllelesT/G
Probe 1AX-89850877.AX-89850877: TAATAAAACTTAATAATAAAGTCAACTCCA
5' Flanking SequenceATGAAATTATTTTGAATTATTATTTCAGTTGAGGT
3' Flanking SequenceATGGATGTTTATTTGGGGGAGCGGGTGGCTCTAGG
SpeciesFragaria x ananassa
Publication[view all]
ContactNahla Bassil
CommentSNP-SNP (haploSNP)
Contact
NameDetails
Nahla Bassil
First name:Nahla
Last name:Bassil
Title:Geneticist
Institution:USDA-ARS, NCGR, Corvallis, OR, USA
Address:USDA-ARS, NCGR, Corvallis, OR, USA
Country:USA
Email:nahla.bassil@ars.usda.gov
Phone:(541) 738-4214
Libraries
Library NameType
90K SNP array for cultivated strawberrySNP_chip
Sequence
>AX-89850877 ID=AX-89850877; Name=AX-89850877; organism=Fragaria x ananassa; type=genetic_marker; length=71bp
ATGAAATTATTTTGAATTATTATTTCAGTTGAGGTKATGGATGTTTATTT
GGGGGAGCGGGTGGCTCTAGG
Alignments
Feature NameTypeLocationAnalysis
Fvb7 chromosome Fvb7:1987889..1987959+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb7 chromosome Fvb7:1980546..1980616+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb7 chromosome Fvb7:10298849..10298915+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb6 chromosome Fvb6:9714389..9714455+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb4 chromosome Fvb4:2647752..2647818+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb4 chromosome Fvb4:11380795..11380864+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb4 chromosome Fvb4:12480897..12480963+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb4 chromosome Fvb4:11298553..11298619+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb4 chromosome Fvb4:11209822..11209888+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb4 chromosome Fvb4:10193229..10193295+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb4 chromosome Fvb4:6542084..6542150+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb4 chromosome Fvb4:8731906..8731947+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb3 chromosome Fvb3:8911262..8911387+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb3 chromosome Fvb3:28152692..28152756+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb3 chromosome Fvb3:28546574..28546618+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb3 chromosome Fvb3:15436342..15436401+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb1 chromosome Fvb1:22724049..22724119+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb1 chromosome Fvb1:19477654..19477724+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb1 chromosome Fvb1:19469221..19469291+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb1 chromosome Fvb1:22839134..22839200+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb1 chromosome Fvb1:20565183..20565249+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb6 chromosome Fvb6:10640660..10640729- Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb5 chromosome Fvb5:21766559..21766624- Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb4 chromosome Fvb4:10004789..10004859- Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb4 chromosome Fvb4:11979484..11979549- Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb4 chromosome Fvb4:15029308..15029374- Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb4 chromosome Fvb4:19343646..19343687- Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb3 chromosome Fvb3:28579942..28580011- Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb3 chromosome Fvb3:28411131..28411197- Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb1 chromosome Fvb1:21619654..21619724- Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb1 chromosome Fvb1:20047629..20047688- Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb5-4 chromosome Fvb5-4:17069420..17069490+ Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
Fvb3-1 chromosome Fvb3-1:13574872..13574939+ Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
Fvb2-4 chromosome Fvb2-4:283602..283636+ Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
Fvb1-1 chromosome Fvb1-1:14079498..14079568+ Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
Fvb7-4 chromosome Fvb7-4:21712716..21712780- Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
Fvb6-4 chromosome Fvb6-4:13543194..13543264- Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
LG7 chromosome LG7:6416693..6416693. Fragaria vesca Whole Genome v1.1 Assembly & Annotation