AX-89906688, AX-89906688 (genetic_marker) Fragaria x ananassa

Marker Overview
NameAX-89906688
dbSNP IDN/A
SNP Array ID
90K SNP array for cultivated strawberry:Affx-88898530
TypeSNP
SNP AllelesC/G
Probe 1AX-89906688.AX-89906688_probe1: TAGTCTGATAGTCTCATACCATTCGGTGTC
Probe 2AX-89906688.AX-89867210_probe2: TAGTCTGATAGTCTCATACCATTCGGTGTG
5' Flanking SequenceAAGTTATGAATACACAAAAAGTGAAAAAGGTGTGC
3' Flanking SequenceTGTGGCTTACCATACTCTGATAGTCTGATGCCTTT
SpeciesFragaria x ananassa
Publication[view all]
ContactNahla Bassil
CommentSNP-SNP (haploSNP)
Contact
NameDetails
Nahla Bassil
First name:Nahla
Last name:Bassil
Title:Geneticist
Institution:USDA-ARS, NCGR, Corvallis, OR, USA
Address:USDA-ARS, NCGR, Corvallis, OR, USA
Country:USA
Email:nahla.bassil@ars.usda.gov
Phone:(541) 738-4214
Libraries
Library NameType
90K SNP array for cultivated strawberrySNP_chip
Sequence
>AX-89906688 ID=AX-89906688; Name=AX-89906688; organism=Fragaria x ananassa; type=genetic_marker; length=71bp
AAGTTATGAATACACAAAAAGTGAAAAAGGTGTGCSTGTGGCTTACCATA
CTCTGATAGTCTGATGCCTTT
Alignments
Feature NameTypeLocationAnalysis
Fvb7 chromosome Fvb7:17154666..17155168+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb7 chromosome Fvb7:17120719..17120789- Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb7 chromosome Fvb7:17204484..17204554- Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb7-4 chromosome Fvb7-4:6654333..6654403+ Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
Fvb7-4 chromosome Fvb7-4:6561798..6561868+ Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
Fvb7-4 chromosome Fvb7-4:5907766..5907836+ Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
Fvb7-3 chromosome Fvb7-3:7469367..7469437+ Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
Fvb7-2 chromosome Fvb7-2:29460866..29460936+ Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
Fvb7-2 chromosome Fvb7-2:29365134..29365204+ Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
Fvb7-2 chromosome Fvb7-2:22618759..22619256+ Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
Fvb7-4 chromosome Fvb7-4:5960113..5960616- Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
Fvb7-4 chromosome Fvb7-4:6615088..6615590- Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
Fvb7-3 chromosome Fvb7-3:7429900..7429970- Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
Fvb7-2 chromosome Fvb7-2:22581328..22581398- Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
Fvb7-2 chromosome Fvb7-2:29421606..29422109- Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
LG7 chromosome LG7:15927796..15927796. Fragaria vesca Whole Genome v1.1 Assembly & Annotation