|
Marker Overview
Name | MEST088 |
Genbank ID | AB627242 |
Type | EST-SSR |
Species | Malus x domestica |
Repeat Motif | (AG)13 |
Primer 1 | MEST088.forward primer: AAACAGCAAAACCCAGATCG |
Primer 2 | MEST088.reverse primer: GGGCTCTATAAATTCCCCCA |
Publication | [view all] |
Contact | Shigeki Moriya
|
Publications
Year | Publication |
2015 | Shigeki Moriya, Hiroshi Iwanami, Takashi Haji, Kazuma Okada, Masahiko Yamada, Toshiya Yamamoto, Kazuyuki Abe. Identification and genetic characterization of a quantitative trait locus for adventitious rooting from apple hardwood cuttings. Tree Genetics & Genomes. 2015; 11:15. |
2012 | Moriya S, Iwanami H, Kotoda N, Haji T, Okada K, Terakami S, Mimida N, Yamamoto T, Abe K. Aligned genetic linkage maps of apple rootstock cultivar ‘JM7’ and Malus sieboldii ‘Sanashi 63’ constructed with novel EST-SSRs. Tree genetics & genomes. 2012; 8(4):709-723. |
|