04f3, 04f3 (genetic_marker) Malus x domestica | GDR

Marker Overview

Marker Overview


Name	04f3
Genbank ID	N/A
Type	SSR
Species	Malus x domestica
Repeat Motif	(GA)14
Primer 1	04f3.forward primer: CAAAACCACCCTCATCCTCGAA
Primer 2	04f3.reverse primer: CCCCAAGCAGACCTGAAGAAA
Product Length	111
Publication	[view all]
Contact	P. Guilford

Contact

Name

Details

P. Guilford

First name:	P.
Last name:	Guilford
Institution:	Horticulture and Food Research Institute of New Zealand
Address:	Horticulture and Food Research Institute of New Zealand, Mt Albert Research Centre, Private Bag 92 169, Auckland, New Zealand
Country:	New Zealand

Publications


Year	Publication
1997	Guilford P, Prakash S, Zhu JM, Rikkerink E, Gardiner S, Bassett H, Forster R. Microsatellites in Malus X domestica (apple): abundance, polymorphism and cultivar identification. Theoretical and Applied Genetics. 1997; 94(2):249-254.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Pear-BD-F1-2015	LG17	N/A	67.8	04f3	View
2	Pear-Bayuehong-F1-2015	LG17	N/A	65.38	04f3	View
3	Pear-Dangshansuli-F1-2015	LG17	N/A	68.67	04f3	View
4	Pear-integrated_consensus_map-IPCG-2017	LG17	N/A	111.04	04f3	View