05g8, 05g8 (genetic_marker) Malus x domestica | GDR

Marker Overview

Marker Overview


Name	05g8
Genbank ID	N/A
Type	SSR
Species	Malus x domestica
Repeat Motif	(GA)18
Primer 1	05g8.forward primer: CGGCCATCGATTATCTTACTCTT
Primer 2	05g8.reverse primer: GGATCAATGCACTGAAATAAACG
Product Length	121
Publication	[view all]
Contact	P. Guilford

Contact

Name

Details

P. Guilford

First name:	P.
Last name:	Guilford
Institution:	Horticulture and Food Research Institute of New Zealand
Address:	Horticulture and Food Research Institute of New Zealand, Mt Albert Research Centre, Private Bag 92 169, Auckland, New Zealand
Country:	New Zealand

Publications


Year	Publication
1997	Guilford P, Prakash S, Zhu JM, Rikkerink E, Gardiner S, Bassett H, Forster R. Microsatellites in Malus X domestica (apple): abundance, polymorphism and cultivar identification. Theoretical and Applied Genetics. 1997; 94(2):249-254.