M15915-27:C>T, M15915-27:C>T (genetic_marker) Fragaria x ananassa

Marker Overview
NameM15915-27:C>T
Genbank IDN/A
TypeDArT
5' Flanking SequenceTGCAGATAGAAATTGTTCCTCAGTTT
3' Flanking SequenceCTCCTGTGGTCGTTCTTGACCATTTCTTCTGTAATTTGATAT
SpeciesFragaria x ananassa
Publication[view all]
ContactIraida Amaya
Contact
NameDetails
Iraida Amaya
First name:Iraida
Last name:Amaya
Title:Researcher
Institution:IFAPA-Centro de Churriana
Address:Cortijo de la Cruz S/N, Churriana, 29140 Ma´laga, Spain
Country:Florida
Email:iraida.amaya@juntadeandalucia.es
Phone:+34 951 036218
Keywords:Strawberry
Last update:2014
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
M15915-27:C>T-LG2M15915-27:C>T-LG2-52.776Fragaria x ananassamarker_locus


Sequence
>M15915-27:C>T ID=M15915-27:C>T|Name=M15915-27:C>T|organism=Fragaria x ananassa|type=genetic_marker|length=69bp
TGCAGATAGAAATTGTTCCTCAGTTTYCTCCTGTGGTCGTTCTTGACCAT
TTCTTCTGTAATTTGATAT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Strawberry-232x1392-F1-2014LGIII-3N/A52.78M15915-27:C>T-LG2View