H24D11, H24D11 (genetic_marker) Rosa spp. | GDR

Marker Overview

Marker Overview


Name	H24D11
Genbank ID	N/A
Type	SSR
Species	Rosa spp.
Repeat Motif	(CT)10
Primer 1	H24D11.Forward: CCTCCTCAGCTTTCCTCCTT
Primer 2	H24D11.Reverse: CAGCAACCATCTCTTCGTGA
Publication	[view all]
Contact	Qixiang Zhang L. Hibrand-Saint Oyant

Contact

Name

Details

Qixiang Zhang

First name:	Qixiang
Last name:	Zhang
Title:	Professor
Institution:	National Engineering Research Center for Floriculture, College of Landscape Architecture, Beijing Forestry University
Address:	35 Qinghua East Road, Haidian, Beijing, China
Country:	China
Email:	Zqxbjfu@126.com
Phone:	+86 010-62336321
Fax:	+86 010-62336321
Keywords:	Prunus mume genome sequence
Last update:	Jan 2015

L. Hibrand-Saint Oyant

First name:	Laurence
Last name:	Oyant
Institution:	UMR GenHort (Génétique et Horticulture)
Address:	UMR GenHort (Génétique et Horticulture), INRA, Beaucouzé, France
Country:	France
Email:	saint@angers.inra.fr

Publications


Year	Publication
2015	Yu C, Luo L, Pan H, Guo X, Wan H, Zhang Q. Filling gaps with construction of a genetic linkage map in tetraploid roses. Frontiers in plant science. 2015; 5:796.
2008	Hibrand-Saint Oyant L, Crespel L, Rajapakse S, Zhang L, Foucher F. Genetic linkage maps of rose constructed with new microsatellite markers and locating QTL controlling flowering traits. Tree genetics & genomes. 2008; 4(1):11-23.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Rose-Sun_City-F1	B5	N/A	47.2	H24D11-158	View
2	Rose-Yunzheng_Xiawei-F1	A5	N/A	68.9	H24D11-158	View
3	Rose-Yunzheng_Xiawei-F1	A5	N/A	69.3	H24D11-164	View
4	Rose-YXxSC_integrated-F1	LG05	N/A	64.5	H24D11-164	View
5	Rose-YXxSC_integrated-F1	LG05	N/A	81.3	H24D11-158	View
6	Rose-YXxSC_integrated-F1	LG05	N/A	98.1	H24D11-161	View
7	Rose-H190-F1	A6	N/A	25	H24D11	View
8	Rose-Rw-F1	B6	N/A	51	H24D11	View