pbr_AX-171774092, pbr_AX-171774092 (genetic_marker) Pyrus x bretschneideri

Marker Overview
Namepbr_AX-171774092
dbSNP IDN/A
SNP Array ID
Axiom 70K Pear Genotyping Array:AX-171774092
TypeSNP
SNP AllelesA/C
5' Flanking SequenceCCTTGGATCCAGCAACAGGATTAACCGCATTTTTA
3' Flanking SequenceTTTCCAGGGATTGAGAAACATCTTTTCCTGCAGAA
SpeciesPyrus x bretschneideri
Publication[view all]
ContactSara Montanari
Contact
NameDetails
Sara Montanari
First name:Sara
Last name:Montanari
Title:Assistant Project Scientist
Institution:Istituto Agrario San Michele all’Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach
Address:Via E. Mach 1, 38010 S. Michele all'Adige (TN) - ITALY
Country:Italy
Email:sara.montanari@fmach.it
Phone:530 754 5743
Keywords:germpalsm repository
Last update:07/27/2018
Libraries
Library NameType
Axiom 70K Pear Genotyping ArraySNP_chip
Alignments
The following features are aligned
Feature Name Type LocationAnalysisReference
Chr1chromosomeChr1:7245628..7245628 .Pyrus communis Bartlett DH Genome v2.0n/a
Sequence
>pbr_AX-171774092 ID=pbr_AX-171774092; Name=pbr_AX-171774092; organism=Pyrus x bretschneideri; type=genetic_marker; length=71bp
CCTTGGATCCAGCAACAGGATTAACCGCATTTTTAMTTTCCAGGGATTGA
GAAACATCTTTTCCTGCAGAA