pco_AX-171778066, pco_AX-171778066 (genetic_marker) Pyrus communis

Marker Overview
Namepco_AX-171778066
dbSNP IDN/A
SNP Array ID
Axiom 70K Pear Genotyping Array:AX-171778066
TypeSNP
SNP AllelesC/T
5' Flanking SequenceGAAACTCTTGCTTCTAAATCGGTTCACAGAGTGTA
3' Flanking SequenceGTGGTGGATGATGAAGGAGAAGTTGTTGGTGTGAT
SpeciesPyrus communis
Publication[view all]
ContactSara Montanari
Contact
NameDetails
Sara Montanari
First name:Sara
Last name:Montanari
Title:Assistant Project Scientist
Institution:Istituto Agrario San Michele all’Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach
Address:Via E. Mach 1, 38010 S. Michele all'Adige (TN) - ITALY
Country:Italy
Email:sara.montanari@fmach.it
Phone:530 754 5743
Keywords:germpalsm repository
Last update:07/27/2018
Libraries
Library NameType
Axiom 70K Pear Genotyping ArraySNP_chip
Alignments
The following features are aligned
Feature Name Type LocationAnalysisReference
Chr13chromosomeChr13:4464855..4464855 .Pyrus communis Bartlett DH Genome v2.0n/a
Sequence
>pco_AX-171778066 ID=pco_AX-171778066; Name=pco_AX-171778066; organism=Pyrus communis; type=genetic_marker; length=71bp
GAAACTCTTGCTTCTAAATCGGTTCACAGAGTGTAYGTGGTGGATGATGA
AGGAGAAGTTGTTGGTGTGAT