pco_AX-171778127, pco_AX-171778127 (genetic_marker) Pyrus communis

Marker Overview
Namepco_AX-171778127
dbSNP IDN/A
SNP Array ID
Axiom 70K Pear Genotyping Array:AX-171778127
200K AXIOM PyrSNP:AX-171778127
TypeSNP
SNP AllelesA/G
5' Flanking SequenceTACCTGAAGCGAACACGCCTGAGTTCATTACTGCC
3' Flanking SequenceTCTGGCAAGGAGCTTAGAGTTATATATACACCAGG
SpeciesPyrus communis
Publication[view all]
ContactSara Montanari
Jun Wu
Contact
NameDetails
Sara Montanari
First name:Sara
Last name:Montanari
Title:Assistant Project Scientist
Institution:Istituto Agrario San Michele all’Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach
Address:Via E. Mach 1, 38010 S. Michele all'Adige (TN) - ITALY
Country:Italy
Email:sara.montanari@fmach.it
Phone:530 754 5743
Keywords:germpalsm repository
Last update:07/27/2018
Jun Wu
First name:Jun
Last name:Wu
Institution:Nanjing Agricultural University
Address:College of Horticulture, State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing 210095, China
Country:China
Email:wujun@njau.edu.cn
Last update:Jan 2019
Libraries
Library NameType
200K AXIOM PyrSNPSNP_chip
Axiom 70K Pear Genotyping ArraySNP_chip
Alignments
The following features are aligned
Feature Name Type LocationAnalysisReference
Chr13chromosomeChr13:4289540..4289540 .Pyrus communis Bartlett DH Genome v2.0n/a
Sequence
>pco_AX-171778127 ID=pco_AX-171778127; Name=pco_AX-171778127; organism=Pyrus communis; type=genetic_marker; length=71bp
CCTGGTGTATATATAACTCTAAGCTCCTTGCCAGAYGGCAGTAATGAACT
CAGGCGTGTTCGCTTCAGGTA