pco_AX-171855670, pco_AX-171855670 (genetic_marker) Pyrus communis

Marker Overview
Namepco_AX-171855670
AliasAX-171855670
dbSNP IDN/A
SNP Array ID
Axiom 70K Pear Genotyping Array:AX-171855670
TypeSNP
SNP AllelesA/G
5' Flanking SequenceTTTAACCACTGAAGATGTGCTCAGAGCTATTGACA
3' Flanking SequenceTGGGAAATCTGAAGGTGGTTCTAGCGGCCAGCACT
SpeciesPyrus communis
Publication[view all]
ContactSara Montanari
Contact
NameDetails
Sara Montanari
First name:Sara
Last name:Montanari
Title:Assistant Project Scientist
Institution:Istituto Agrario San Michele all’Adige (IASMA) Research and Innovation Centre, Foundation Edmund Mach
Address:Via E. Mach 1, 38010 S. Michele all'Adige (TN) - ITALY
Country:Italy
Email:sara.montanari@fmach.it
Phone:530 754 5743
Keywords:germpalsm repository
Last update:07/27/2018
Libraries
Library NameType
Axiom 70K Pear Genotyping ArraySNP_chip
Sequence
>pco_AX-171855670 ID=pco_AX-171855670|Name=pco_AX-171855670|organism=Pyrus communis|type=genetic_marker|length=71bp
TTTAACCACTGAAGATGTGCTCAGAGCTATTGACARTGGGAAATCTGAAG
GTGGTTCTAGCGGCCAGCACT
Alignments
Feature NameTypeLocationAnalysis
Chr1 chromosome Chr1:1552967..1552967. Pyrus communis Bartlett DH Genome v2.0