Md-PAL, Md-PAL (genetic_marker) Malus x domestica | GDR

Marker Overview

Marker Overview


Name	Md-PAL
Genbank ID	N/A
Type	PCR marker
Species	Malus x domestica
Primer 1	Md-PAL.forward primer: AGACCCTCAATGCCTCAGAA
Primer 2	Md-PAL.reverse primer: CAAGCCAGAACCAACAGCAG
Publication	[view all]
Contact	Fabrizio Costa
Comment	primers to test gene expression

Contact

Name

Details

Fabrizio Costa

First name:	Fabrizio
Last name:	Costa
Title:	Researcher
Institution:	Research and Innovation Centre, Foundation Edmund Mach
Address:	Via Mach 1, I-38010 San Michele all’Adige, Trento, Italy
Country:	Italy
Email:	fabrizio.costa@iasma.it
Phone:	390461615358
Fax:	390461650956

Publications


Year	Publication
2013	Di Guardo M, Tadiello A, Farneti B, Lorenz G, Masuero D, Vrhovsek U, Costa G, Velasco R, Costa F. A Multidisciplinary Approach Providing New Insight into Fruit Flesh Browning Physiology in Apple (Malus x domestica Borkh.). PloS one. 2013; 8(10):e78004.