FYPP3_2

Marker Overview
NameFYPP3_2
dbSNP IDN/A
SNP Array ID
Cherry 6+9K SNP array:FYPP3_2
TypeSNP
SNP AllelesT/C
5' Flanking SequenceAGGCTTCTTGCATGGATATGATTAACAGTTTCTTAGATTCTGTAATTTTG
3' Flanking SequenceGTGTTAATCAATTGAAAGAAGCACTTATCCCATGAATGTTAGTTTAGCTT
SpeciesPrunus avium
Publication[view all]
ContactStijn Vanderzande
Commentsweet cherry SNPs from ESTs discovered by Castede et al (2015)
Contact
NameDetails
Stijn Vanderzande
First name:Stijn
Last name:Vanderzande
Address:Laboratory for Fruit Breeding and Biotechnology - Willem de Croylaan 42 - B-3001 Heverlee - Belgium
Country:Belgium
Email:stijn.vanderzande@wsu.edu
Libraries
Library NameType
Cherry 6+9K SNP arraySNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
FYPP3_2FYPP3_2Prunus aviummarker_locus


Sequence
>FYPP3_2 ID=FYPP3_2|Name=FYPP3_2|organism=Prunus avium|type=genetic_marker|length=101bp
AGGCTTCTTGCATGGATATGATTAACAGTTTCTTAGATTCTGTAATTTTG
YGTGTTAATCAATTGAAAGAAGCACTTATCCCATGAATGTTAGTTTAGCT
T
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Sweet Cherry-RosBREED-3.8K-20201N/A92.73FYPP3_2View
Alignments
Feature NameTypeLocationAnalysis
Pp01 chromosome Pp01:32681733..32681733. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
PAV_r1.0chr1 chromosome PAV_r1.0chr1:27183067..27183067. Prunus avium Whole Genome Assembly v1.0 & Annotation v1 (v1.0.a1)