GH17-101_2

Marker Overview
NameGH17-101_2
dbSNP IDN/A
SNP Array ID
Cherry 6+9K SNP array:GH17-101_2
TypeSNP
SNP AllelesA/G
5' Flanking SequenceACAATTTCCAAAGACCCTCCGCCCGCCTTCTCAAGAGCGGCATAAACAGC
3' Flanking SequenceTCCAAAATGGCATCGAAAAGATTACGATAGCCACGTTGGCCATCTTGTAC
SpeciesPrunus avium
Publication[view all]
ContactStijn Vanderzande
Commentsweet cherry SNPs from ESTs discovered by Castede et al (2015)
Contact
NameDetails
Stijn Vanderzande
First name:Stijn
Last name:Vanderzande
Address:Laboratory for Fruit Breeding and Biotechnology - Willem de Croylaan 42 - B-3001 Heverlee - Belgium
Country:Belgium
Email:stijn.vanderzande@wsu.edu
Libraries
Library NameType
Cherry 6+9K SNP arraySNP_chip
Sequence
>GH17-101_2 ID=GH17-101_2|Name=GH17-101_2|organism=Prunus avium|type=genetic_marker|length=101bp
ACAATTTCCAAAGACCCTCCGCCCGCCTTCTCAAGAGCGGCATAAACAGC
RTCCAAAATGGCATCGAAAAGATTACGATAGCCACGTTGGCCATCTTGTA
C
Alignments
Feature NameTypeLocationAnalysis
Pp07 chromosome Pp07:8969523..8969523. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)