GH17-61

Marker Overview
NameGH17-61
dbSNP IDN/A
SNP Array ID
Cherry 6+9K SNP array:GH17-61
TypeSNP
SNP AllelesT/C
5' Flanking SequenceAACAAAAATATATATATCAGACACTTGAAATTTGAAACTCTGTTTTCTCT
3' Flanking SequenceCATCCAATTGAATTCAATCTTCTTTGCTATTTTCTGTTTTGAGATCAGTT
SpeciesPrunus avium
Publication[view all]
ContactStijn Vanderzande
Commentsweet cherry SNPs from ESTs discovered by Castede et al (2015)
Contact
NameDetails
Stijn Vanderzande
First name:Stijn
Last name:Vanderzande
Address:Laboratory for Fruit Breeding and Biotechnology - Willem de Croylaan 42 - B-3001 Heverlee - Belgium
Country:Belgium
Email:stijn.vanderzande@wsu.edu
Libraries
Library NameType
Cherry 6+9K SNP arraySNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GH17-61GH17-61Prunus aviummarker_locus


Sequence
>GH17-61 ID=GH17-61|Name=GH17-61|organism=Prunus avium|type=genetic_marker|length=101bp
AACAAAAATATATATATCAGACACTTGAAATTTGAAACTCTGTTTTCTCT
YCATCCAATTGAATTCAATCTTCTTTGCTATTTTCTGTTTTGAGATCAGT
T
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Sweet Cherry-RosBREED-3.8K-20206N/A44.78GH17-61View
2Sweet Cherry-C-F1-6+9K_array6N/A53.02GH17-61View
3Sweet Cherry-VxC-F1-6+9K_array6N/A46.26GH17-61View
Alignments
Feature NameTypeLocationAnalysis
Pp06 chromosome Pp06:10122354..10122354. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
PAV_r1.0chr6 chromosome PAV_r1.0chr6:9591281..9591281. Prunus avium Whole Genome Assembly v1.0 & Annotation v1 (v1.0.a1)