scaffold_1:7972170

Marker Overview
Namescaffold_1:7972170
dbSNP IDN/A
SNP Array ID
Cherry 6+9K SNP array:scaffold_1:7972170
TypeSNP
SNP AllelesA/G
5' Flanking SequenceCCTTTCCCATAGGTTATTAGAGGCCTTGTCATAGACAAAGAGAAAGGCAACTTAGTGAAG GCTGATCGATTTGGTTATGTAAAGAGGGCTATGCATGGCAC
3' Flanking SequenceAAGATGCTATCTAATCGAGCTGTAAGGTACACTATGAAGCTTTTTTTTTATTAGTCTCAT AGTGCAAATGCAAAGCAGGCATTCAGTGTGCTGTTAAAACA
SpeciesPrunus avium
Publication[view all]
ContactStijn Vanderzande
Commentweet cherry SNPs identified by Peace et al (2012) that were not used for the original 6K SNP array - intragenic SNPs
Contact
NameDetails
Stijn Vanderzande
First name:Stijn
Last name:Vanderzande
Address:Laboratory for Fruit Breeding and Biotechnology - Willem de Croylaan 42 - B-3001 Heverlee - Belgium
Country:Belgium
Email:stijn.vanderzande@wsu.edu
Libraries
Library NameType
Cherry 6+9K SNP arraySNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Sweet Cherry-C-F1-6+9K_array1N/A16.24scaffold_1:7972170View
2Sweet Cherry-VxC-F1-6+9K_array1N/A1.94scaffold_1:7972170View
Sequence
>scaffold_1:7972170 ID=scaffold_1:7972170; Name=scaffold_1:7972170; organism=Prunus avium; type=genetic_marker; length=203bp
CCTTTCCCATAGGTTATTAGAGGCCTTGTCATAGACAAAGAGAAAGGCAA
CTTAGTGAAGGCTGATCGATTTGGTTATGTAAAGAGGGCTATGCATGGCA
CRAAGATGCTATCTAATCGAGCTGTAAGGTACACTATGAAGCTTTTTTTT
TATTAGTCTCATAGTGCAAATGCAAAGCAGGCATTCAGTGTGCTGTTAAA
ACA