AX-105218703

Marker Overview
NameAX-105218703
dbSNP IDN/A
SNP Array ID
50K SNP array for apple:AX-105218703
TypeSNP
SNP AllelesT/C
5' Flanking SequenceTGTCGGGATGTGTGCATACGATTGCATACATGAGA
3' Flanking SequenceAGCTCATGGTATTAGCATAAGGCGCCTTCTCCATT
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
50K SNP array for appleSNP_chip
Alignments
The following features are aligned
Feature Name Type LocationAnalysisReference
Chr01chromosomeChr01:7590125..7590125 .Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotationn/a
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-BB-F11N/A3.82AX-105218703View
2Apple-NC-F11N/A0.17AX-105218703View
3Apple-NCZFBB-consensus1N/A0AX-105218703View
4Apple-ZF-F11N/A0.57AX-105218703View
Sequence
>AX-105218703 ID=AX-105218703; Name=AX-105218703; organism=Malus x domestica; type=genetic_marker; length=71bp
TGTCGGGATGTGTGCATACGATTGCATACATGAGAYAGCTCATGGTATTA
GCATAAGGCGCCTTCTCCATT