fruit acidity

QTL Overview
QTL LabelqFRACD.NCZFBB.6.H
Published SymbolMa4
Trait Namefruit acidity
Trait AliasN/A
Trait StudyApple-fruit_acidity-Rymenants-2020
PopulationN/A
Female ParentN/A
Male ParentN/A
Colocalizing MarkerGDsnp02169
RosBREEDSNP_SNP_GA_1307443_Lg6_02169_MAF30_MDP0000296767_exon13
Neighboring MarkerN/A
EnvironmentN/A
LODN/A
Additivity Dominance RatioN/A
R2N/A
Commentspredictive markers: GDsnp02169; RosBREEDSNP_SNP_GA_1307443_Lg6_02169_MAF30_MDP0000296767_exon13
Contact
NameDetails
Marijn Rymenants
First name:Marijn
Last name:Rymenants
Title:researcher
Institution:Better3fruit
Address:Steenberg 36, 3202 Rillaar
Email:marijn@better3fruit.com
Phone:+32 (0)16 24 16 10
Keywords:genetics
Map Positions
#Map NameLinkage GroupBinChromosomePeakSpan StartSpan StopMapViewer
1Apple-NCZFBB-consensus6N/AN/A317View
Alignments
Feature NameTypeLocationAnalysis
Chr06 chromosome Chr06:1062876..1073607. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
MDC012082.287 contig MDC012082.287:1414..1414. Malus x domestica Whole Genome v1.0 Assembly & Annotation
MDC021451.276 contig MDC021451.276:9740..9740. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Sequences
The following sequences are available for this feature:

QTL from alignment at Chr06:1062876..1073607

Legend: genetic_marker
Hold the cursor over a type above to highlight its positions in the sequence below.
>qFRACD.NCZFBB.6.H ID=qFRACD.NCZFBB.6.H; Name=fruit acidity; organism=Malus x domestica; type=QTL; length=10732bp; location=Sequence derived from: Chr06:1062876..1073607 (Malus x domestica
GTCTTGTTAACATGTGATGATGATTTAGAGGAGTGTGTTGATGTGTGCCG GTCTTCAGAGAGCCGCACAATTAAGCTCTCTCTCCAGATATCTCGTCATC ACTTGAAAGGTTTGATAGGTAGACCGTCATGATAGTAAGATGCTTGTCTG AGTTTGCAAACACTAAAGTAGCAGAAGTCTGCAGTCAATAAAGTATGGAT GCATCCGTTAGTTTTAGTAGGTATGTTGAAACCTTGCTTCATGGATCGCT GCTCCAAGCATATGAAATCTTCGCAATGTAAAGATGGAAGTTTTGCGTCG TGCAGAATTAAACGAAAGGATGGTGGGAAAGGAACATCTGGGATCTCCAT CTGAAATTGCAGCAGCTTGAATGTATTTTGTTAGTCTAGTAGCTAGCAGT TAGTGACTTAGTGTATTCCTATTTTTTTTCTTTTCCTTTTGTTAATTACT AGTGGATGGTTGTCTGTGTATTTACATAATTTTTTGCCAATTAAAATAGT CCTGTTTATATATATTTATTTTTAAGGAAAACTAATGAAAAATGCTTGAA AACTTTGAGTTTTAATGATAAGGGCAAAATAAATGATAAAGTGAATAGGA TCATGATTGATTTTTTAGTGTAAAAATATGGTTTTTCGTTAAAGTAAATA GTACTGAAAGCTTTTCGTTGAAGTTCCCTTTTTAATATGTGAATTGGGAA TGCTTGTGCCAGATTTCTAAGCATTGAGTCAATTTCCAGAGGAAGAATTT GCTTTCAGATGAAGCTTTAATAACACAATTAAATGGGTTTGTTTCCTATC AGATCAGATGTTGGTAAATCTTTTCAGGGTGTTGGGAGACTTTAGATGCT CAATTGGGTTTCTGCTTTATAATGCGAATGTTCCGTGAAGGGTATTAATT GGAAGAAAAGAAAAGGGTTTATGACTATTTCGTTTCTAGTTTTCATTTGT CTGTTAGAGATATCGAAGAAAATACATTGAAAATAGTTAACTGAAGTAGG ATCGAAAATGCGTTTATCATTGAAGTATACAATGTCAACTACTATAAGCA TCGGCTCCCGAAATGATAGATTGTCGTGACGAAACTACCAGCTGGTCCCT TTAAAAGAAAAGAAAGAAAAAACCTCCTATGAGCATCAAGAAATTGTGTT AGAAGCGTCCTAGAAACTACACAAATTGTGAGTCCTACCATATGTGATGT AGGACGAATAAGAAGGATTTTAAAAGAATGATAGAAAACTTGGAATTCAC TCAATCAGGATCAACGAAGCAAGATCAAGGTCATTAATCGCGGATTCAAT CAATATTACCAAGTCATGCTTGATTTGAGAAAGAAATCATTTACTTCAAT TGCACACGCAAATATAATATTTAATTAATCAATTCACCCCAAGACCTCTA GTACATCATTTTGTAAAGAAACTAAAGACAGAGGATCAACTTCGTCAGAA ACTCTCGCCATTCTCTGACTTAACAAATTCCTATGTTATTATTCCAATGC AATTAGTGGTCTTCAATTTTTTTTTTCCAATAAAAAAAGGATTCTTTTCA AATAAAAAAAAGAAAAAAAAAGAAGAAGGTTCTTTTCAAGGTTTGACTAC CGCATCAAAACAAGTTTTCAATCAAAAAAATTGAAAAATGAAAACAGAAT AGTTGTCAAATAACGTCTTAATAAACCACTAATTGGATGCATCCTAAACG GAATAGTTTTCTGAGTTCTTTTGTTCTAAGGTTAACATATCTTTATACAT TGATGTATGATACTTACGCCAAAGGAAGTTGATGCTAGCCAAACAGACAA ATCTCAAAATCTACTATTTTCTTGCTCTTTTTTGTTTTGTGTTCCTTTGT CAGCAGCAGCAGTTGTATAATTTACATATTCAACTATTTCGATATTTCTG TTATTCGGTTCGTACATAATAATTCAGCTGTAAAAGAACACGAAAAAGAA CTGGCTGAGGTAGTAATCCGCTATCTTCATAGTTGTGGGGAAACAGATGT CTGATCTTGTCTCTGCTCAACAGGCACGCGTCTTGAAGGCGGACCAAACA CGCTCAAGAAGACCTGTAAACAAAACGTCGTTATGTACTAGTTGATCAAA ATTCAAAAACAGACTAGTGCAAGACATGGTTTCTATCTCTATTCAACACA TTTTCTTTTCAGATGCTAGTTATTGTTCAAGAATTTTATAATTTCCGTCG AGGATGGCGAGGACGTGATAAGGTAACTGTACTAACTTACCGGCAAGAAC ACAAGCCCATGTAAGAAACCAAGAAGAACCAATGCTAGGTACATTTGGAA ATAATACACCTACAAAACATAAGAGGAAAAGATGTGTTCAAAGGGATCCG ACAGTAATGGCCAGTATGATTAGACCGTGAGTAAAAGATTTAGTACCACA AAGATTTCCGTCCTCGAGAAACAAAGTACAATAACCCCAACTAACTTTGT TAATGTGATTCCACTGCAAAAGAATGTCAAGAGAGAATGGAAATGTAAGC TTAGATCGGATAAAATTTATCACACAAAATCCTATTGGCACTGCACTTGA GACTTTAGCTATTTGGTAAAGAATGATCAATCGCAGAAGATGCCCGGAGA TGGGAACAAAACAAAGTAGGAGTTGAATTTCCCCCTTTCTTCCGAAGGAG GGTCGGAATTGGGCTAGTTACCTGAATACAGAGGCACCCATTGTAGCCAG AGCCTCCTTGGTGCGCTGGTCTTTATCTCCTGTGCTAACCTGCACAAGAA ATGTTAATTATACACTTCAGAAGAAAAAGGTAGCATGTTGTCGCCAATGA TAACTTTGATTCTGTTCTGTGAAGCCAAAATCAAAATACCCCAAGATTTG AAGGGACTTTAGGCATCACAGAAACTAACAATAGCGAGAAAGAGAAGGCA AAAGTAAATAACTAAAGATAATGTTTAAGAGTTTGACACTGACCGAGAAA GCATGTGTCATATGCACACAAAACTCAACCGAAATGCCCACTGCCATTAC AAGATTCACAACAGAGACTGCATTCAATTGGATGTTCAGAATTGCCATCA CACCCTGTAGAATGTTATCTAGTGAGCAAATGTGACCACTAACAGGAGGT ATTATTTTGTTTCAAAAGAGAAATTTTAACGAAGAAAGATCACCATGAGA TCCACTAAAATCATTGCCAACACCAACAGAATAATAGCTGAACTCCATAA ACTACAAAACAAATTTGAAGGAAGCAACAATATATCATTATAAACACCTC TTTGCAAATTTTATTTGCTAAGGAAGCTGAATACAACGAGTTATCTTGCA CACAATTACAAGAATTAAACGAGGCTAAGAATATGAATACTGACCTGCAT GTGATAGCTAAACAAACAATAAACACAGCAGCTGGTACACCAAAAATTAT ATCCAGATTAATCCTTTTAATAAATGAAACCACAAATCTACCATATGCAT ATCTATAGTAGATAGATACAAGCTGAAATTAAAATCCGCGTTCCAGAGAG GTTACATTTGAATTTTATGAATTTTTTCCCCACTAAGATATAGTATTCAA AGCTATAAAAAAAACTAACCAATGGCTATAGAAAGGTTGATCAGTGCTGT TCTCCAAATATCAAGGTATTGCTCAAAGAACATATAGTAAACTGAATATG GGAATATCTCAATCTGCACCAGAAAATAAATATCAGTTCCACAGGTATAC CACGAGCAACGCACTAGTGAATCAAGCTAACTTATTATAGTAACTGTCCC CGTGTAAATAAATAAAGAAATTATGAACCAGTGGCTTATGGAAAGGGGCA ACACAAGACTGTTGTACTCAATCTAAATGTAGCATTTGGGGTCTCTTGTC AAATGAATCAAATGAACCAATGGACATTAACCCTTTTCCCATTTGCATGG GTTGTGATGTGGGCATAATAGACACCGCGTCGTTTGCAGATGTGGGCACA CCCACATTGGCTAGAGCGGATGTGCCACCCCCTATGCACTCAAGTTTGAA TCTCCCTCCCCACAATTTAGATTAGTTTAAACTAGAATATTGCTTAAAAA AAAACTAGAATATTTGCTTGTATCAAAAACAAAAACAGAGTATAGGAGTC ATCCTTTTGCATAGTTTTCATATTGGGTTGCTTCACCACAATTCCGTTTT GAGCTATGTTTTCTACTTATTTACAATACAGATTTTGGTGTAGCTTTATA ATATTAAAGTTGTACTGTAAATAAATCAATCGACTTAGCAAGTAGCCTTC AAATTTTTACCTTCAAAGAATCAGAAAGTCTAGAACTGAGCTCCCGAGCA GCTCTCATTGAATTTACGTAGTCAACCTAAAATAAATATGTAGATATTTA AGTTATGGGGCTTACTTTAGTGTTGAAACCTAGAAAAGACGGGAAGTGGT AATCTTTTTTGATTGATCACAAGATGAGATACCTGCTTGTTGAGAGGAGT ATGATATGTTCGAAATGATGATGCTTGAATAATGCCACTTTCATTGCCTG ATAATAAAAATATGATTAACATGTTAAAAATGTAGATTCAAATAAAAAGC TACATCTAATGGAAGTTTAACCTGAAAGCAGATAAGCCGTTTGGAAAGAG AAATCATAAGGGCACAATATTCCATCAACAAACCTTTGAATTCCACACTG CTAGTGTAAGCTCCATGGCCACCTTTAGCACAATCATTAGAGGGTAGAGC ATTGAGGAACCATGGAAGTTTTTCTTTAAATTGTGTGGTAGAGGGACGGT CATTGTGAAGATCTGAGTGACGAAAGCACTGACAACAACAAAATTGAAAA TGAGAATGGATGTGTTCCCCTATAAACAAAGAAATTCAGTTAAAATATTT CTGTCATGCCATGCGTATATTACCGTAGTACAGTCTTTGCACACTCCACC AAGGCTACAGGAACTATCACTGGGAGAGCAGCAAGGTGGCTGGAAAAGTG GAAAGAGTAAAACTTAAATTTAGTAGCAAGGGGATTGCAAGCAAAACAAA AACAAGATGATTTGTGCTCTAACAGATTTATAAGCGGACAAGAAAAGCAT CATTATCATTAATTCTCTTTTACATGTAAAAGAAACTCCAAAACTGAAGA CATTTCAACAATTTTGAATGTAAAACAAATTCCAAACATCAGACCACGCT TCCATAAGCATACTAACAATCATACTAAGAAAAATGTACCGTCACCTGAT CATCAGGAGGGCAGTAAGTCCCATCTGTAAACTTCCGACAGCACCCAAAT GCTTCTGGAGATATCCACACAAGAAAATCATCAAGCCATGAAGCAGCAGG CTTAGCAATGTAACTTGATTCTGGATTTAAGGATGCTCTTGCAATCTGTG GAAAGAAAAGGACAATTAACACAAAGAAAAGGACAAATCAAATTCAGACA TAGAAAAACAAACGATTCAAATACATACATACAAACGGACAAATCAAACA CATAAATTCTGAAATTAGGGATGGTCTAGCATTTCTGCAGATGCAGAAGG ACAACTCACAAATTCACACACACATACCAAAACAGAAACTAAGGGGCAAT CAAAATAACGGATACCATATCCCTGACACGTATTGGTTGATCAAAGAAGG ATCCATAGGCACAAGAATGAAGGACATGGAAAATTTAATAGCCGAGTTAA AGAATAAAAGCTCAAAGAGATATGTACCAATTCACATTCATAGGAAAATG AACAGACAATTCAGATATTAAAAAGCTAGACCTTTCCCGCAATACATATC ATATTAAATGTATTATGTACTACTCTCTCTTTATAATTACAGATTGAGAA AACCTCAACATATAATATACTAATCACCCTAAATATGAATTAAGCTTAAC ACATCAATCACTCTGGATTAGCAGTAAGATTGAAAAGAACCAGCTTGAAT TAGCAAGAGACATTAATTGTTGTATGATTATCAAGGAAATACTGGCATGT GAACAAGAAAAATGCAGGGGGCATTTTATGCTTTAAAACAGCATCCAAAA TCTTATAATTTTCCCATTATAAAGAGAACAAAGAAGGTTTTACCTCATTC AAAAGAGAATCTGAATCACACTGGCTAATTGAGCATAATTGGTTCGTATG TCTTGATTCTGAACTGAGGGACAGAGCAACATCAGAATGAAGCAGAGTTT CAGCGAACAGAAGCATTAAGATAAGTGTTTGCAAAAAAAAAAAAAATTAA TAATAATAATAATTGACATCGTAAATGCATACATGAAAAGGCAAATGGAG AAAATTCCTTTTATGACTACAAATAGTTGCTTTCATATGCAGATGTATGC GTGCCAACTGTCCATGGGATGCGATTCCTAAAGAAAATAGTAGTTCTGAT GGATAGCCACCATTGGGCATTTGGATGAAAAATCAAATGAAATGCTGAAG CACATAGTTGAAAGGCAAACATTTCAATCAGATTATATGTGATTTTCTGG ATAGAGCATCAGCAGCAATTTCAAGAACTCATGACTGCTACACAATATGG TTTATATGTTGACCTAAGAACTAGACATTCATAGCTAGTTTGGTTACATA CATCAAACAACAGTGAACATGAATAGCAGTATGATACCTATAATTGAAGT TCTTCACAACAAAGTATAGTGGGGGTCCAATTCGGAGATACTCCGAAACA TTATTGAAATACCCCTGCAATATATAAAAGACAGCGTTACCTCAAAGAAA GAACAGAGTAATCAATAGCAAAAACGCATTTTTATAAGTAGGCAACTGAC TTATAGACCTGAAGATAGGAGTCTCGGGGAAGAACAATCTTTTGTTCCAA ACCAGGCTGAATTCTGGTGCATAATGCCTATAAAGTTCAAAAGAATCAGA AGTTAACTGAGGAAGGTGCGGCCACAAACAGTAAATGGATATTCACATAG ATATGAAATATATGATACGTTAGGAGGAAGACTCAAAACTCACAATACTA GCCAATGCAAATGCAACAAAGATGGAAATGACAACCATCTTGACTCCCCA AAGACTGAGAATGGGAGCATGGATCTCCTGGAAATGCAAAACAAACAAAA AATGGAGAAAAAACAGCATTGTTAGAAATTAGGTAAGCAGAAAGTAAATG ACTATCATCACAGAATTACCAGAGTTTTTGAAATAAAAAAATAGCATCAA AGTTTTTATTGACAAGCCAACATTCTATTCCTTAAAAGGTTTAAGCCCTT GTACATAGAAAAGTATGAAAATCATGGTAGATTGGTAATTCCAACTGCCT ATATCATCCCTACGATCCATCCACATGGTTTTGTAAGACAGTTTACTGTA GTAAAAAAAAGCAATCACCTTCATATAACGAGTCAATAAACCAGGATTGT TCTGATCAATACCTAAATAAAACAGCATTCAAAAGAAAAACATAATATGA GAATGAGAGTAGGGTTGATTGAAAATTAGTGTTGGCATTAAGGAAATGCA TCAATCTGAATCAAGTTATAAAAACATTCCGATACCTTTGTCAGAGTTGG CATATGATGAAATTTTCATGCATGGGAAACAATCAACCCTCTTATCCTCA GTTCTCCGAAAATCAAAAACAATCAAAGCTACAAATGCAGTAACTTGAAG GAGAAAGTCCAGCAGAACAGCAAGTGCTGCAGAAGAATGTGCAAGAGTAA GTTTGGAGGCCTGAGGTCAGACAGCAAGACAACAAAAACGTATAACAACT ATTTCATATATCTAAAAGTTATTATGGATCAGAATTTCCAACCTGCAAAC ATGGAGAACACGCGGCATGCTGGCATAGGAATAAAACTTCCAACTGCAAA CGCTAAGACCTCTGATAGACTAGCTAGTGTAATTGATGGTCCAACTTCCA CAAGTGCATTGCTTATTCGCCCTTCTAAAGGCAACTCCAAGGGTTGCCGT TTGACAGCATTCACCAGTATACACATATTATCTACCCCAACCTATACACA TTGTGAACAATTTGGCAAACCAAATTTTCAAGCAATATGTAATTATGTAT ATATGTATATATATAGACATACATTGTATATAATATAAACAATTTGGCAA ACCAAATTTTCAAGCGATATGTATGTATGTATATATATAGACATACATTG TATGTATAATATATGTAAGAATATCGAGGAACTTACAGCTAGAACAAGAA ATGGAATAACTTCCATGATGATTAAGGTAGATTTTACACCTATAACACTG AAAAATCCCACTGATCCAAGAACTGACAGCATGACAAGCACAACCCCAGA GAGACCAAGCAATACCTGGAATTCAAACGTGCACAATTATAGTGACAGAA ATGATGTCTCAATTTTGAATCAGAGGAAAACCAAACACATACAAATAGGG CAGTATTTTCCAGTAACTTAAAACAAACTAAAATAGTTGAGAACATACCT TAGACGAAATGTAAAATGATGATAAACGAGGTGAATCACCCAAAGTAAGA GATATATAAGCAAACATCACAAGATAGCTTATCTGCAGTGAAACACGAAA CCATAAATAGATTAGTAATTTAAAAGATTCAAATGATAAATGAATAAAAA AATTATTTAACCCACATACTATATCATGTACAGTACTTATGCATTATAGA TATTCTGAGCTTTGATTATAAAAGGAAACATGCAACTAAAATAGTATAGA TATTCTGAGCTTTGATTATAAAAGGAAACATGCAACTAAAATGAAAGAGA GAAAACACTTACCAATATTGTAATAGCATCTGCTGTACTTTCTCTTTTAA GTTCTTCTTCAACAGAGCTTTCCGATGAAAAAGAAAGTGTTAAGTTTCTA GATTGCACCATTTGCAACAATTCATCCTATCACAAAAACGAAACAATAAA CGGTTATGAGAGAAATGTCTACTTTCATTCGGGACAGGATGGTAACACAA ACAAGAATGCAAAAAGTAAACAATTACAAGAATTATGCTAGACAAAGAGT AAACCTTTGCAAGCTCAATAAAGGCTTTCTCCCATGCCAATGCCCTTTCA GTTTCATTCCCATCATTACTACGAGCATTGTTTACAGGATAAGTTACAAG AAATGCTGACGCCTGCATTGAAAAGAATCATAATGGTCGATAAATACTCA AAGAATTCGATCTTCTTATCAACTTAAGAAGGTGAAAAAAAAATGAATTT GTTCATGAAAAAACAGAAAAATCGTTACCTCAGAGTAGTTTTTCCCAGAG AAGCCTCCTAATGCTGTGCTAGGATCAAGAGGACCTTTAAATGCACTCAT ACATGTGTCGGCAGATGAATAGTGCTTCAATAACACAAAACACAAATGTT AATAGGTCTACTTTCCATAACCGTATTGCCATGTTCTTTGAGAATTTTGG AATGGTAAAAATAGCAAGAAAATCAATTATAGAACAAGCTGGAGAGAAAT GTAAGTATATTAAAATGTGAGTTTGGTCATTTTACCAGATGACTACGGCT TATCTAGAAGGAAAAAAAGGGAAAATATGGACAGATCTCTATGTTCTCAT TATTTGAGAAATTGAGCAGAAAATAGATGCACATAATAATAATATAGATC AAGCAATGTGATGAGCAACAGAGACATTAGTTTTATCCATCAGCCTTAAA TAAAAATTAATAAAAACAATATTGTTTTGTGTTACCAACCCTGACATTCT ACAAATAACAACAACAACAACAACAAAAAAGCCTTTTCCCACTAAGTGGG GTCGGCTATATGAATCCTAGAACGTCATTGCGCTCGGTTTTGTGTCATGT CCTCCGTTAGATCCAAGTACTCTAAGTCTTTTCTTAGGGTCTCTTCCAAA GTTTTCCTAGGTCTTCCTCTACCCCTTCGACCCTGAACCTTTGTCCCGTA GTCACATCTTCGAACCGGAGCGTCAGTAGGCCTTCTTTGCACATGTCCAA ACCACAGTAACCGATTTTCTCTCATCTTTCCTTCAATTTCGGCTACTTCT ACTTTACCTCAGATATCCTCATTCCTAATTTTATCCTTTCTCGTGTGCCC ACACATCCAACGAAGCATCCTCATCTCCGCTACACCCATTTTGTGTACGT GTTGATGCTTCACCGCCCAACATTCTGTACCATACAGCATCGCCGGCCTT ATTGCCGTCCTATAAAATTTTTCCTTGAGCTTCAGTGGCCTACGACGGTC ACAAAACACGCCGGATGCACTCTTCCACTTCATCCATCCAGCTTGTATTC TATGGTTGAGATCTCCATCTAATTCTCCGTTCTTTTGCATGATAGATCCT AGGTAGCGAAAACGGTCGCTCTTTGGTATTTCCTGATCTCCAATCCTCAC CCCTAACTCATTTTGGCCTCCATTTGCACCGAAACTTGCACTCCATATAT TCTGTCTTTGATCGGCTTAGGCGAAGACCTTTAGATTCCAACACTTCTCT CCAAAGGTTAAGCTTCGCATTTACCCCTTCTTGAGTTTCATCTATCAACA CTATGTCGTTTGCGAAAAGCATACACCAAGGATACTACTATAAGATAGTG ATCAAGCATACTATAAAATAACATACCTATAAAATAGTGATCAAGCATAC TACTATAAGATGCACATATGATGGACCATGGATCATGAATCTCATTAGAC AATAAACTAGATTTACACTTCAGATAAGTTGTAGATGGAAATTATAAGAA TATACCTCAAAACAATACTTTAGGTGTTCAACCCCACCATAACCATCATA ATTTGCAGGATCCATTTTGAAGTACTGGAACG
back to top

QTL from alignment at MDC012082.287:1414..1414

Legend: genetic_marker
Hold the cursor over a type above to highlight its positions in the sequence below.
>qFRACD.NCZFBB.6.H ID=qFRACD.NCZFBB.6.H; Name=fruit acidity; organism=Malus x domestica; type=QTL; length=1bp; location=Sequence derived from: MDC012082.287:1414..1414 (Malus x domestica
G
back to top

QTL from alignment at MDC021451.276:9740..9740

Legend: genetic_marker
Hold the cursor over a type above to highlight its positions in the sequence below.
>qFRACD.NCZFBB.6.H ID=qFRACD.NCZFBB.6.H; Name=fruit acidity; organism=Malus x domestica; type=QTL; length=1bp; location=Sequence derived from: MDC021451.276:9740..9740 (Malus x domestica
Y
back to top