LFY, LFY (gene) Crataegus sp. 2001_29

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Crataegus sp. 2001_29
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500503.1-LFYCrataegus sp. 2001_29gene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500503.1-LFY.m1Crataegus sp. 2001_29mRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYCrataegus sp. 2001_29gene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU500503.1-LFY N/A EU500503.1
mRNA parsed from NCBI nr database EU500503.1-LFY.m1 N/A EU500503.1

Sequence(s):
>EU500503.1-LFY1057
gaagcaggcgtaacgccagtagcggcagctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacggcggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgaaatgatgagcagcctctctcatatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaaggtactatacgctatattatataca
tgaatattatttacccttatgtcttagattaaccgtagtatataggcatataggtagggtttgattacactttgaaataa
cattattttacatgtaaattaatagtgtgacaatataacatgttcaaacagatgataaaaaagaattagaatttagtgaa
tcaaagaagaaaaataggtcgcaaaacattaaaacttttggcctttggtgtaataatttgatggaaataacaaatcaaag
atgtttattattttgtgacatactatgccagatcataagatgttcgagattgcgtgataaaactaaaagcatatgtttta
tatgattgtaacataatatgtcaattatcgtagtctttgatactagaacataaagtagttgttatattagattgggatat
atgacacgctgtgcatgggatgtgtaggactgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagta
gggatggcgtgggaggttgtgacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactg
tagtgctggagggggtcataataatgatcataacgagggtgtagacgacaaggacgacgacatggacgacatgaatgggc
aggggaacggtggagga
back to top
>EU500503.1-LFY.m1588
gaagcaggcgtaacgccagtagcggcagctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacggcggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgaaatgatgagcagcctctctcatatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaagtgcaacaagagaaggagatggtgg
ggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaa
tataggaactgtagtgctggagggggtcataataatgatcataacgagggtgtagacgacaaggacgacgacatggacga
catgaatgggcaggggaacggtggagga
back to top