LFY, EU683932.1-LFY.m1 (mRNA) Crataegus submollis

Unique NameEU683932.1-LFY.m1
OrganismCrataegus submollis ()

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYEU683932.1-LFYCrataegus submollisgene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYCrataegus submollisgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
EU683932.1-LFY.m1-cds1EU683932.1-LFY.m1-cds1Crataegus submollisCDS
EU683932.1-LFY.m1-cds2EU683932.1-LFY.m1-cds2Crataegus submollisCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
LFYEU683932.1-LFY.p1Crataegus submollispolypeptide

This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Feature NameTypeLocationAnalysis
EU683932 region EU683932:1..1052+ NCBI Rosaceae gene and mRNA sequences
Cross References
External references for this mRNA
The following sequences are available for this feature:

mRNA sequence

>EU683932.1-LFY.m1 ID=EU683932.1-LFY.m1|Name=LFY|organism=Crataegus submollis|type=mRNA|length=588bp
back to top

protein sequence of LFY

>EU683932.1-LFY.p1 ID=EU683932.1-LFY.p1|Name=LFY|organism=Crataegus submollis|type=polypeptide|length=196bp
back to top

mRNA from alignment at EU683932:1..1052+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU683932.1-LFY.m1 ID=EU683932.1-LFY.m1|Name=LFY|organism=Crataegus submollis|type=mRNA|length=1052bp|location=Sequence derived from alignment at EU683932:1..1052+ (Crataegus submollis)
gaagcagccgtaacgccagtagcggcagctgctgcggcggcggctggtta tactttgcggccgccaagggagcttggacttggagggcttgaagacttgt tccaggcttatggggttagatactacacggcggcgaagatagcggagctt ggatttactgtgaacaccctcttggacatgaaggatgatgagcttgatga catgatgagcagcctctctcagatattccgctgggagttgcttgttgggg agaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgag gaggaggactctcggcggcgcaaccttgtctctggtgataccaccaccaa tgccctagatgctctctcccaagaaggtactattcgctatattatataca tgaatattatttacccttatgtcttagattaaccgtagtatataggcata taggtagggtttgattacactttgaaataacattattttatatgtaaatt aatagtgtgacaatataacatgttcaaacagaaaaaagaattagaattta gtgaatcaaagaagaaaaataggtcgcaaaacattaaaacttttggcctt tggtgtaataatttgatggaaataacaaatcaaagatgtttattattttg tgacatactatgccagatcataagatgttcgagattgcgtgataaaacta aaagcatatgttttatatgattgtaacataatatgtcaattatcgtagtc tttgatactagaacataaagtagttgttatattagattgggatatatgac acgctgtgcatgggatgtgtagggctgtcggaggagccagtgcaacaaga gaaggagatggtggggagcggagtagggatggcgtgggaggttgtgacgg cgggggagaggcggaagaagcagcggaggatgaagaaggggcaatatagg aactgtagtgctggagggggtcataataatgatcataacgagggtgtaga cgacaaggacgacgacatggacgacatgaatgggcaggggaacggtggag ga
back to top

Coding sequence (CDS) from alignment at EU683932:1..1052+

>EU683932.1-LFY.m1 ID=EU683932.1-LFY.m1|Name=LFY|organism=Crataegus submollis|type=CDS|length=588bp|location=Sequence derived from alignment at EU683932:1..1052+ (Crataegus submollis)
back to top