LFY, EF127056.1-LFY.m1 (mRNA) Crataegus triflora

Unique NameEF127056.1-LFY.m1
OrganismCrataegus triflora ()

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYEF127056.1-LFYCrataegus trifloragene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYCrataegus trifloragene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
EF127056.1-LFY.m1-cds1EF127056.1-LFY.m1-cds1Crataegus trifloraCDS
EF127056.1-LFY.m1-cds2EF127056.1-LFY.m1-cds2Crataegus trifloraCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
LFYEF127056.1-LFY.p1Crataegus triflorapolypeptide

This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Feature NameTypeLocationAnalysis
EF127056 region EF127056:1..418+ NCBI Rosaceae gene and mRNA sequences
Cross References
External references for this mRNA
The following sequences are available for this feature:

mRNA sequence

>EF127056.1-LFY.m1 ID=EF127056.1-LFY.m1|Name=LFY|organism=Crataegus triflora|type=mRNA|length=210bp
back to top

protein sequence of LFY

>EF127056.1-LFY.p1 ID=EF127056.1-LFY.p1|Name=LFY|organism=Crataegus triflora|type=polypeptide|length=70bp
back to top

mRNA from alignment at EF127056:1..418+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>EF127056.1-LFY.m1 ID=EF127056.1-LFY.m1|Name=LFY|organism=Crataegus triflora|type=mRNA|length=418bp|location=Sequence derived from alignment at EF127056:1..418+ (Crataegus triflora)
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcga ttacctcttccatctctacgagcaatgccgcgatttcttgatccaggtcc agaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtacgaagt tttacccatctcccctctttacgtacgctgatttctactgtggcaattaa ttaacagtaaaaattcttgtacgaagtccgtcaaatttaccatttcgtgt accacatacataacgatctggtrcaaggtattaacggaagttggaacaaa atgtataatttcgttttgcatttgtttgctctttacattatatatgcagg tgacaaatcaagtgtttaggtatgccaaaaaggcaggggcaagctacatc aacaagcccaaratgcgc
back to top

Coding sequence (CDS) from alignment at EF127056:1..418+

>EF127056.1-LFY.m1 ID=EF127056.1-LFY.m1|Name=LFY|organism=Crataegus triflora|type=CDS|length=210bp|location=Sequence derived from alignment at EF127056:1..418+ (Crataegus triflora)
back to top