2_625535, 2_625535 (genetic_marker) Fragaria iinumae

Marker Overview
Name2_625535
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
2_6255352_625535Fragaria iinumaemarker_locus
2_6255352_625535-46.126Fragaria iinumaemarker_locus


Sequence
>2_625535 ID=2_625535|Name=2_625535|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGTGTGTTTTTGTGTATATGACTTCGTTTGTTGAAATTCAAGGCAACCAT
AGCAGCCTAGTTTC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii6N/A46.132_625535View
2Fragaria-Fii6N/A46.132_625535-46.126View