47_757717, 47_757717 (genetic_marker) Fragaria iinumae

Marker Overview
Name47_757717
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
47_75771747_757717Fragaria iinumaemarker_locus
47_75771747_757717-0.483Fragaria iinumaemarker_locus


Sequence
>47_757717 ID=47_757717|Name=47_757717|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGCTACATTTGGTCCTAAAGTTGAACAACGGAAAGAGTTATATAATA
ACTATGGCAGGTTG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii7N/A0.4847_757717View
2Fragaria-Fii7N/A0.4847_757717-0.483View