TP3948, TP3948 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP3948
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP3948TP3948Fragaria iinumaemarker_locus
TP3948TP3948-45.643Fragaria iinumaemarker_locus


Sequence
>TP3948 ID=TP3948|Name=TP3948|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGTCATGCCCAAATTATATATTAGATCTTTACATATCTTAATTAGCT
AGCAAGGCGTGGAT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii6N/A45.64TP3948View
2Fragaria-Fii6N/A45.64TP3948-45.643View