CBF4, CBF4 (gene) Fragaria x ananassa

Gene Overview
Name CBF4
Gene Symbol CBF4
Type gene
Organism Fragaria x ananassa
Synonym C-repeat binding factor 4
Description NA
Comment CBF4
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CBF4HQ910515.1-CBF4.m1Fragaria x ananassamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
C-repeat binding factorCBFFragaria x ananassagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database HQ910515.1-CBF4.m1 N/A HQ910515.1

Sequence(s):
>HQ910515.1-CBF4.m1595
atgctcgagtcttcttctcactccgataacaacagcggcggcgttgggcggatggccttgtcagacgaggaggtcatgct
ggcggagacgtacccgaagaagagggcgggaaggaagaagttcaaggagacgaggcacccggtttaccgcggtgtgagga
ggagaaactccggcaagtgggtttgcgaggttcgtgagccgaacaagaagacgaggatttggcttgggactttccccact
accgaaatggctgcgcgtgcccacgacgtggcggcgattgccttgaggggccggaatgcgtgtttgaactttgccgactc
ggcgtggcggctgccggtgccggcttctaatagtgctaaggacatacagacggcggctgctgaggcggcggaggcgtttc
ggcctaataggggggaatcggaagttgtgtcgaaagcgacggaggcggtggaagaggaatcggaacaaccggtgttttat
atggacgaggaggatgtgtttgggatgccggggttgctggccaacatggcggaagggatgctactgccgcctcctcacta
taacggatacggaggagacgaatatgaagggcgaa
back to top