CYP, CYP (gene) Fragaria x ananassa

Gene Overview
Name CYP
Gene Symbol CYP
Type gene
Organism Fragaria x ananassa
Synonym cysteine protease
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CYPJN979371.1-CYP.m1Fragaria x ananassamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cysteine proteaseCYPFragaria x ananassagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database JN979371.1-CYP.m1 LG6:35085956..35088200
JN979371.1

Sequence(s):
>JN979371.1-CYP.m11065
atgtcgacctccatgaccctaaccctcttcaccctcctcttcctctccttcaccctctctcacgcctccgacctccgcac
cgatgccgaggtccgggagctctaccagaactggctcgtcaagcaccagaaagtctacaacggcatcggagaggaggaga
ccaggttccagatcttcaaggacaacttgaagttcgtcgatgaacacaacgctgagagcaggtcgtacaaggttggcatg
aacgccttcgccgacttgaccaaccaggagtaccgtgctaggtttctcggaacccgccctgaccctaagaggagggtcat
gaaggccaagaaccccagcctcaggtacgttgtccgccccgacgacaagttgccggaatccgtcgactggagagctttgg
gggctgttaacccgatcaaaaaccaaggcagctgcggaagttgctgggcattttcaactgtggctgcagtggaaggcatt
aacaagatagccacaggagaactagtctctctttcagagcaagagcttgttgactgtgacaggaagtacaacgctggctg
caacggaggccttatggactatgctttcgagttcatcatcaaaaacggtggcatggacaccgaatcagactacccttaca
aagcagtcaaccaacagtgtgacgcttctttggagaacaacaaggttgttaccattgatggttacgaagatgttccagct
ttcaacgaggaggctttgaagaaagctgtagcacatcaacctgtaagtgttgccattgaagctggtggcgttgctcttca
gctctatgactcgggtgtgtttaccggtgaatgtggatcagcacttgatcatggtgtggttgctgttggttatggcactg
agaatggtgtggactactggctggtgaggaactcatggggaaccaactggggtgagggtggatatttcaagatcgagcgc
aatgtgaagagcacatatactggcaagtgtggtattgccatggaggcttcttacccgaccaaggatagtgcacagaaccc
aatccagatggtcaccagcatgtga
back to top