ANR2A, ANR2A (gene) Malus x domestica

Gene Overview
Name ANR2A
Gene Symbol ANR2A
Type gene
Organism Malus x domestica
Synonym anthocyanidin reductase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ANR2AJN035300.1-ANR2A.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
anthocyanidin reductaseANRMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly JN035300.1-ANR2A.m1 Chr05:45822429..45824663
chr5:2237237..2239373
chr5:2230379..2232604
chr5:2243505..2245739
chr5:2430079..2432313
JN035300.1

Sequence(s):
>JN035300.1-ANR2A.m11020
atggccacccaacaacccatctcaaagaagacggcttgcgtcgtcggcggcaccgggttcgtggcgtctctgctggtcaa
gctgctgctccagaagggctacgccgtcagaaccaccgtcagagacccagacaatcacaagaaggtctcccacctcacat
cactacaagagttgggtgagctagagattttagcaggagatctgactgatgaagggagcttcgatgctccgatagcaggt
tgtgatcttgttttccatgttgcaacccctgtcaactttgcctcagaggacccggagaacgacatgatcaaaccggcaat
ccaaggggtactaaacgttctgaaatcgtgtgtgaaggccaaaacagttaagcgtgttgttttgacatcatcagctgcta
cagtttcgatcaatacacttgagggaacaggtttggtcatggacgaaaaagattggagtgatttggagttcttgactact
gtaaagccacccacttgggggtaccctgcctccaagacactagctgagaagacagcttggaaattcgccgaagagaacaa
tattgatctcatcactgtgatcccttctcttatggctggtccttctctcactccagacgtccccagcagtatcggccttg
ccatgtctttaatcacaggaaatgatttcctcataaatatggccttgaaaggtatgcaaatgctatcaggttcgatatcc
atttcacatgtggaggatgtctgccgggcgcatatatttttggctgagaaagaatctgcttctggtcggtacatttgctg
tgctgccaacaccagcgttcctgagcttgctcggttcctcaacaaaagatacccccagtacaaagtccccactgagtttg
gagattttccgtccaaggccaaattgatcatctcttcggagaagcttatcaaggaggggttcgattttaagtatggcatc
gaagaaatatatgaccaaactgtggagtacttcaaggccaaggggttgctgcagaactag
back to top