BZIP13, BZIP13 (gene) Malus x domestica

Gene Overview
Name BZIP13
Gene Symbol BZIP13
Type gene
Organism Malus x domestica
Synonym BZIP domain class transcription factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
BZIP13HM122465.1-BZIP13.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
BZIP domain class transcription factorBZIPMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM122465.1-BZIP13.m1 Chr06:3326240..3331978
chr6:3272023..3277761
chr6:4047127..4052865
HM122465.1

Sequence(s):
>HM122465.1-BZIP13.m11221
atgggtagcagagagatggacaaacctgctaaagagaaagagaaggagacgaagacaacacctgctactacgcaggagca
gcctgcgactactagtactggcactgttaatcctgactggtcgggatttcaggcatattctccaatacctccacatggat
ttatggcctcaagtcctcaagctcacccgtatatgtggggggttcagcatattatgccaccatatggtacccctccacac
ccatatgttgcaatgtatccccatggcgggttatatgctcacccgtctatgcctcctggatcttatccttttagcccgtt
tgctatgcctactccaaatggcattgtagaggcttctggtaacacacctggaagcatggaagcagatggtaagccatctg
aggtaaaggaaaaattaccaataaaacgatcaaagggaagcttgggcagtttgaatatgattacagggaagaataacgag
cttggcaaaacatcaggagcctctgctaatggagtttattccaaaagtgctgagagtgctagtgatggtacaagtgaagg
aagtgatgcaaattctcagagtgactcccaattgaagtcagggggcaggcaagattctttggaaggtgatgtatctcaga
atggcagttcagcacatggttcccagaatggagcaccgcataccatgttgaatcaaacaatggccatcatgccattaacg
gctgctggtgctcctggtgctgtttctggtcctgcaacaaacttaaatattgggatggactattggggtgctccaccttc
tgctgccatgcctgcaatgcgtgggaagattccaactactccagtatcagcaggaatagttactgctgggtctcgggata
gtgttcagtcacagattcggttacaagatgagagagagatgaaaagacagcgaagaaagcagtcaaatagggaatccgct
cgtcgatctaggttgcgcaagcaggcggaatgtgatgagctggcccagcgtgctgaagtcttaaaagaagaaaataacac
tctaagatcagaagttaaccagatcaggagcgagtatgagcagcttctctcagagaatgcttctctaaaggagaggcttg
gagaaattcctggtcacggagatatacggtctgccagaagtgaaccacatttgggcaatgacactaaacagaatgcacat
acagaacagcatggccactag
back to top