HMG3, HMG3 (gene) Malus x domestica

Gene Overview
Name HMG3
Gene Symbol HMG3
Type gene
Organism Malus x domestica
Synonym 3-hydroxy-3-methylglutaryl coenzyme A reductase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
3-hydroxy-3-methylglutaryl-CoA reductaseHMGMalus x domesticagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
HMG3AY043491.2-HMG3.m1Malus x domesticamRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly AY043491.2-HMG3.m1 Chr02:8742014..8744240
chr2:8562395..8564622
AY043491.2

Sequence(s):
>AY043491.2-HMG3.m11140
aaacgcggttcgttcgctggagggcctgccgtggagggattcgattatcggtcgatactgggacagtgctgtgagaatcc
ggtggggtatgtgcagatcccggtgggagtcgccggaccgctgcttctcgacggagaagagtacatggtgccaatggcga
caacggaggggtgcctggtggccagcaccaataggggattcaaggcaatctacgcctcaggcggcgccgagagtgtcctc
ttcaacgactccatgaccagagctccaattgtgaggttccactccgtcgttagggctgctcagctcaagttcttcgtcga
gaaccctctcaattttgatgctctcgccgtcgttttcaacatgtctagcagatttgcaaagctcgaaaagattcgatgcg
cgatagcaggcaggaatctgtacctaaggttttcatgcagcactggagatgccatggggatgaacatgatctccaaaggc
gtccaatgtgttatcgaattccttcaaaatgaattcccagacatggaagttgttggcatctctggaaacttctgctcaga
caagaaagcagcagccgtaaattggattgaagggcgagggaaatcagtaacttgcgaggcagtcatcaaggaggaattgg
tgaggaaagtactgaaaaccgatgtggattcccttgtgaagcttaacgtgaataaaaaccttgttgggtctgccatggct
ggtgctcttggcgggttcaacgcccacgccagcaatattgtctctgcagtcttcatagccactggccaggaccctgctca
gaatattgagagctctcactgcattaccttgatggaagccgacggcaatgaccttcatatctcagtcaccatgccttcca
ttgaggtgggtacagttggaggaggaacacaactcgcatcccaatcagcctgcttgaacttgctcggtgtcaagggcgca
ggcaaagactctccaggtttaaactcaaggcaactggcgagaattgtagctggagctgtcctagcaggggagctttctct
catgtcagccatcgcatccgggcagctagtgaagagccacatgaaatacaaccgatctaacccagacgttgcaaaccttg
cctcggtaaaacaccggtag
back to top