Hi04a08, Hi04a08 (genetic_marker) Malus x domestica

Marker Overview
NameHi04a08
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1Hi04a08.primer 1: TTGAAGGAGTTTCCGGTTTG
Primer 2Hi04a08.primer 2: GTTTCACTCTGTGCTGGATTATGC
Product Length211-250
PolymorphismP_ Hi04a08
Publication[view all]
ContactA. Patocchi
Andreas Peil
Miyuki Kunihisa
Contact
NameDetails
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Country:SWITZERLAND
Email:andrea.patocchi@acw.admin.ch
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Andreas Peil
First name:Andreas
Last name:Peil
Title:Researcher
Institution:Institute for Breeding Research on Fruit
Address:Kulius Kuhn-Institut (JKI), Pillnitzer Platz 3a, 01326
Country:Dresden, Germany
Email:andreas.peil@jki.bund.de
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2014Wöhner TW, Flachowsky H, Richter K, Garcia-Libreros T, Trognitz F, Hanke M, Peil A. QTL mapping of fire blight resistance in Malus ×robusta 5 after inoculation with different strains of Erwinia amylovora. Molecular breeding. 2014; 34(1):217-230.
2012Schouten HJ, van de Weg WE, Carling J, Khan SI, McKay SJ, van Kaauwen MPW, Wittenberg AHJ, Koehorst-van Putten HJJ, Noordijk Y, Gao Z, Rees DJG, Van Dyk MM, Jaccoud D, Considine MJ, Kilian A. Diversity arrays technology (DArT) markers in apple for genetic linkage maps. Molecular breeding 2012 29:645–660
2014Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2004Plant Breeding, 123(4):321
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map5N/A12.3Hi04a08View
2Apple-FD-F1-2006D5N/A19.5Hi04a08View
3Apple-IM-F1-IdaredIda LG 5N/A9.5Hi04a08View
4Apple-IM-F1-Mr5Mr5 LG 5N/A12.8Hi04a08View
5Apple-2000-2012-F1ch5N/A19Hi04a08View
6Apple-OA-F1-AkaneAK5N/A2.3Hi04a08View
7Apple-X3259X3263-F15N/A0Hi04a08View
8Apple-RGxPI6-F1LG5N/A17.2Hi04a08View
9Apple-FD-F1-2006F5N/A13.1Hi04a08pView
10Apple-JM7xS63-F1J5N/A27.1Hi04a08View
Alignments
Feature NameTypeLocationAnalysis
Chr05 chromosome Chr05:43602080..43602291. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr5A chromosome chr5A:41388960..41389171. Malus x domestica ‘Honeycrisp’ Genome v1.1.a1 Assembly & Annotation