Hi07d11, Hi07d11 (genetic_marker) Malus x domestica

Marker Overview
Genbank IDN/A
SpeciesMalus x domestica
Repeat MotifGT
PCR Conditionannealing temp 60 degree
Primer 1Hi07d11.primer 1: CCTTAGGGCCTTTGTGGTAAG
Product Length200-232
PolymorphismP_ Hi07d11
Publication[view all]
ContactA. Patocchi
Cindy F. Verdu

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1Hi07d11.primer 1Malus x domesticaprimer
primer 2Hi07d11.primer 2Malus x domesticaprimer

This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fruit textureqFT.XX-ch11.1Malus x domesticaQTL

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Hi07d11Hi07d11Malus x domesticamarker_locus
Hi07d11yHi07d11yMalus x domesticamarker_locus
Hi07d11.zHi07d11.zMalus x domesticamarker_locus
Hi07d11xHi07d11xMalus x domesticamarker_locus
Hi07d11_M2Hi07d11_M2Malus x domesticamarker_locus

Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Cindy F. Verdu
First name:Cindy
Last name:Verdu
Address:INRA, UMR1345 Institut de Recherche en Horticulture et Semences, Beaucouze, France