|
Marker Overview
Name | Hi07d11 |
Genbank ID | N/A |
Type | SSR |
Species | Malus x domestica |
Repeat Motif | GT |
PCR Condition | annealing temp 60 degree |
Primer 1 | Hi07d11.primer 1: CCTTAGGGCCTTTGTGGTAAG |
Primer 2 | Hi07d11.primer 2: GTTTGAGCCGATTAGGGTTTAGGG |
Product Length | 200-232 |
Polymorphism | P_ Hi07d11 |
Publication | [view all] |
Contact | A. Patocchi Cindy F. Verdu
|
Publications
Year | Publication |
2006 | Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224. |
2012 | Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203. |
2015 | Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119 |
2002 | Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241. |
2004 | Plant Breeding, 123(4):321 |
2014 | Verdu CF, Guyot S, Childebrand N, Bahut M, Celton J-M, Gaillard S, Lasserre-Zuber P, Troggio M, Guilet D, Laurens F. QTL Analysis and Candidate Gene Mapping for the Polyphenol Content in Cider Apple. PLoS ONE. 2014; 9(10):e107103. |
|