IPT5B, IPT5B (gene) Malus x domestica

Gene Overview
Name IPT5B
Gene Symbol IPT5B
Type gene
Organism Malus x domestica
Synonym adenylate isopentenyltransferase
Description NA
Comment cytokinin biosynthesis enzyme
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
IPT5BHQ585950.1-IPT5B.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
isopentenyltransferaseIPTMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HQ585950.1-IPT5B.m1 Chr16:15761178..15762183
chr16:14059601..14060606
chr16:15187531..15188536
HQ585950.1

Sequence(s):
>HQ585950.1-IPT5B.m11005
atgagaattctcatgtctgcctgcaaacaagtagtacagccgatggtgagcttccatggccccgcgctcaccaacatcaa
catggatccatttttccggagaaaagataaggttgtgatcgtaatgggagccaccgggactggcaagtcccggcttgcca
tagacctcgcaatgcattatccggcggagattataaactcggacaaaatgcaagtctacaaaggcttggacatcgtcacc
aacaaagtcactgaggaagagtgtaaaggcataccccaccatttgataggcaaattcgatcccaactcaaattttactgc
caatgatttcaagaaccatgcatcgttggccatcgaatccatcttggagcgtgacagactcccgatcattgcgggtggtt
cgaattcgtacattgaagccttggtggataaacactcggagtttcgaatgaagtacgagtgttgctttctttgggttgat
gtggccatccctgtgctccactctttcgtgtcgaagagagtggatcggatggtgaaggtgggtttggtggacgaggtgag
gaaaatgtttgactctacaactgaagcagaatatacgaatggaatcaggcaagccataggcgtgcctgaaatgcatgagt
atttacactgtgaagcgagtggtagtaacgatgatgaaacccaagagaggcttcttcaagcagcaatttctaaaatcaag
gaaaatacttgcattttggcgtatcgccaattgcaaaagatccgccggctgcaagctcggcggggttggaacatgcaccg
ccttgatgccacggaagtgttcttaaagcaccaaggggaggcggatcaagcatgggaaaaattcgtggcaacacccgcca
cgcggatggtggataagttccttttgaacccaattccctccattcttccgacagaggccatcatcacgccaccgcgattc
tttccacgtctatgccgacagtggctgccgcaacacggtaactag
back to top