LFY, EU500490.1-LFY.m1 (mRNA) Mespilus germanica

Unique NameEU500490.1-LFY.m1
OrganismMespilus germanica ()

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYEU500490.1-LFYMespilus germanicagene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYMespilus germanicagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
EU500490.1-LFY.m1-cds1EU500490.1-LFY.m1-cds1Mespilus germanicaCDS
EU500490.1-LFY.m1-cds2EU500490.1-LFY.m1-cds2Mespilus germanicaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
LFYEU500490.1-LFY.p1Mespilus germanicapolypeptide

This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Feature NameTypeLocationAnalysis
EU500490 region EU500490:1..689+ NCBI Rosaceae gene and mRNA sequences
Cross References
External references for this mRNA
The following sequences are available for this feature:

mRNA sequence

>EU500490.1-LFY.m1 ID=EU500490.1-LFY.m1|Name=LFY|organism=Mespilus germanica|type=mRNA|length=573bp
back to top

protein sequence of LFY

>EU500490.1-LFY.p1 ID=EU500490.1-LFY.p1|Name=LFY|organism=Mespilus germanica|type=polypeptide|length=191bp
back to top

mRNA from alignment at EU500490:1..689+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU500490.1-LFY.m1 ID=EU500490.1-LFY.m1|Name=LFY|organism=Mespilus germanica|type=mRNA|length=689bp|location=Sequence derived from alignment at EU500490:1..689+ (Mespilus germanica)
gaagcagccgtaacgccagcagcggcggctggttatacttttcggccgcc aagagagcttggacttttagggcttgaagacttgttccaggcttatgggg tcagatactacacggcggcgaagatagcggagcttggatttactgtgaac accctcttggacatgaaggatgatgagcttgatgacatgatgagcagcct ctctcagatattccgctgggagttgcttgttggggagaggtatggtatca aagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcgg cggcgcaaccttgtctctggtgataccaccaccaatgccctaaatgctct ctcccaagaaggtactatacgctatatacatgaatattatatactagaac ataaagtagtttgttatattagattgggatatatgatacgcggtgcatgg gatgtgtagggctgtcagaggagccagtgcaacaagagaaggacatggtg gggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcg gaagaagcagcggaggatgaagaaggggcaatataggaactgtagtgctg gagggggtcataacaatgatcataacgagggtgtagacgacaaggacgac gacatggacgacatgaatgggcaggggaacggtggagga
back to top

Coding sequence (CDS) from alignment at EU500490:1..689+

>EU500490.1-LFY.m1 ID=EU500490.1-LFY.m1|Name=LFY|organism=Mespilus germanica|type=CDS|length=573bp|location=Sequence derived from alignment at EU500490:1..689+ (Mespilus germanica)
back to top