ppa022463m.g, ppa022463m.g (gene) Prunus persica

Gene Overview
Nameppa022463m.g
Unique Nameppa022463m.g
Typegene
OrganismPrunus persica (Peach)
Sequence length2126
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Prunus persica Whole Genome v1.0 Assembly & Annotation2012-01-16
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
Isopentenyltransferase 5.2IPT5.2Prunus persicagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
ppa022463mppa022463mPrunus persicamRNA


Cross References
External references for this gene
DatabaseAccession
"Phytozomeppa022463m.g"
Alignments
Feature NameTypeLocationAnalysis
scaffold_1 supercontig scaffold_1:11483700..11485825- Prunus persica Whole Genome v1.0 Assembly & Annotation
Sequences
The following sequences are available for this feature:

gene sequence

>ppa022463m.g ID=ppa022463m.g|Name=ppa022463m.g|organism=Prunus persica|type=gene|length=2126bp
ATGGATCCATTTTTCCGGCGAAAAGATAAGGTTATCTTTGTAATGGGAGC
CACCGGGACTGGCAAGTCCAGGCTTTCCATAGACCTCGCAGCCTGTTTCC
CTGCTGAGATTATAAACTCTGACAAACTGCAAGTCTACAGAGGCCTGGAC
AAAGTCACTGAGGAGGAGTGTAGAGGCATACCTCACCACTTGCTACGCGA
AATCGATCCAAGCTCAAACTTCACGGCCAATGATTTCAAGCACATCGAAT
CGATCTTCATCGCCGGTGGTTCGAATTCCTACATCGATCGGACGGTGGGT
TTGCTGGATGAGGTCAGGAGAACTGAAGCTGACGAAACCCGAGCGGCTAC
TTCTAAAATTAAAGAAAGCGCTTGCCAATTGCAAAAGATCCGTCGCCTGC
ACAGCCGACGAAACTGGAACATGCACCGCCTCGATCGATGCTACACAAAT
TTTCTTCAAGCACCACGTGGAGGCCGATCAAGCATGGGAAAAACTCGTGG
CAAGAACCAAGCTCCTACATAGATGAAGTGCGCAGTGGTCCCTGGCCCAC
ATACCTACAATCTCCATTTGACATGATACCACGTGGCAGGTTGCATGTTT
TGTTTTGTTTTGTTTTTGTTGTGGGTTTTAAGCTTTTTTTCTTTTTTCTT
CTTTGGGATTGGGAGTGAATCCTTCTGTGGCATCATTGTCATTTCTGTGT
CTTGTTATCTTGATCGATTTTTAACGACGTGACTTTGGAGGCACTCTTGC
TGCCTCAATTGAACGTGCAATCTATCTAAACGTTAAACAAAAGTCACCAC
CAAGGAAGGAGCATAACATTATTTTTATATGGGTCCAATGACCCACCACA
AACATGAAATTATAGTTATATTTCAAGTATTAAAAAAAAAATAATGATAC
ATTTTTTGAGTTAAGGTGGTGAAAAAAATGTTATTATTATTGAATGGTGC
TGATTGATTTAGAGCTGTGATGGATCCCATTGAATTTCCTTTTCTTTCTC
AAAACAAGCTTTTTTTCTTTTATTTGGGTAGAAATCGCTTTTCATTAACT
TAAATAGTTTATAGTGTGATCAGTCAGTGACGTGATTGGTGGCAAATTGG
CAATTGTCTCTTGTCTACTACTAACCAAGACAAGGCGATGGTGTTGCTCA
TGCATTGGCTCAATTTGGATTGCGATAATGGCAGTTTTTTGTATGGGAAG
ATGCAGTACCGCCATGGTGGTTGGTTTTTTTAGCAAAATATTGGGAGGGA
ATGAGTATTTAGTTTTTGTAGGTAGGGAGGAGCTGCAGTGCCCCTATAGC
CCGAGCAGGCCCCATGCGGAAGAAAAAAGTTGAGCCCACGTGAGTGACAC
AAGAAGCTACTTCACTCTCCTCAACGCAGCTGCTCCATCTACTCGCCCAT
CAGCACATGCATTCAACCAACTTTTGGCCATCCAACACACCAATTGGTTT
TTGAAAATGAGTACTCACCCTCATCATTGAAGATGCTCTAGCTGCTCAAG
CATTATTCAACACTTTTTATTATTATTATTGTGCAATTCAATGTTCCCTA
TAAAACACACGTACTTTAAGTTTTTCACACCACCAATATCATTCACCACA
TTTATTTAATTCTACTTAATTTCATAAAATTATTTAATAATTGTTGGTTT
TTTTTATTTATTATTTTTGGTAATCTCTCAACATCCTTATGAAAAAATTA
TTTAAAAAATATATAAATCAAAGGTTGTTTTCTTTAGTTTAATGTTGTTT
TTATTTAAGTCGTTTGTACTCATTTTATGTTCAACGTCTTAATGATATGT
GTGTTTGTTGTTCCGGAATATAGTCTTAATTTGATTATTTTGTTGTTAAA
ATGATCATAAATGAAAAAACAAAAAAACAAAAACTAACATCATATAAAAT
ACATGAACAGAAAATAAGTTAACAAACAACATAGAATAAATCAAAGTACA
TCATAAAAATCCAAATATAAAGCCCCCCATCGTGAGAAAGATACCTTTAG
AGCCCAGAATATTTCATTGGAGCTCTAAATGAGGCTCTATCCACCATTTT
TGTAGCCCCATTTAGAGACTATGATTTGGGATGCCCTAAGGCCATTCCCA
ATGATTGGGGCTCTAAAAGAGGTTGA
back to top

gene from alignment at scaffold_1:11483700..11485825-

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>ppa022463m.g ID=ppa022463m.g|Name=ppa022463m.g|organism=Prunus persica|type=gene|length=2126bp|location=Sequence derived from alignment at scaffold_1:11483700..11485825- (Prunus persica)
ATGGATCCATTTTTCCGGCGAAAAGATAAGGTTATCTTTGTAATGGGAGC CACCGGGACTGGCAAGTCCAGGCTTTCCATAGACCTCGCAGCCTGTTTCC CTGCTGAGATTATAAACTCTGACAAACTGCAAGTCTACAGAGGCCTGGAC AAAGTCACTGAGGAGGAGTGTAGAGGCATACCTCACCACTTGCTACGCGA AATCGATCCAAGCTCAAACTTCACGGCCAATGATTTCAAGCACATCGAAT CGATCTTCATCGCCGGTGGTTCGAATTCCTACATCGATCGGACGGTGGGT TTGCTGGATGAGGTCAGGAGAACTGAAGCTGACGAAACCCGAGCGGCTAC TTCTAAAATTAAAGAAAGCGCTTGCCAATTGCAAAAGATCCGTCGCCTGC ACAGCCGACGAAACTGGAACATGCACCGCCTCGATCGATGCTACACAAAT TTTCTTCAAGCACCACGTGGAGGCCGATCAAGCATGGGAAAAACTCGTGG CAAGAACCAAGCTCCTACATAGATGAAGTGCGCAGTGGTCCCTGGCCCAC ATACCTACAATCTCCATTTGACATGATACCACGTGGCAGGTTGCATGTTT TGTTTTGTTTTGTTTTTGTTGTGGGTTTTAAGCTTTTTTTCTTTTTTCTT CTTTGGGATTGGGAGTGAATCCTTCTGTGGCATCATTGTCATTTCTGTGT CTTGTTATCTTGATCGATTTTTAACGACGTGACTTTGGAGGCACTCTTGC TGCCTCAATTGAACGTGCAATCTATCTAAACGTTAAACAAAAGTCACCAC CAAGGAAGGAGCATAACATTATTTTTATATGGGTCCAATGACCCACCACA AACATGAAATTATAGTTATATTTCAAGTATTAAAAAAAAAATAATGATAC ATTTTTTGAGTTAAGGTGGTGAAAAAAATGTTATTATTATTGAATGGTGC TGATTGATTTAGAGCTGTGATGGATCCCATTGAATTTCCTTTTCTTTCTC AAAACAAGCTTTTTTTCTTTTATTTGGGTAGAAATCGCTTTTCATTAACT TAAATAGTTTATAGTGTGATCAGTCAGTGACGTGATTGGTGGCAAATTGG CAATTGTCTCTTGTCTACTACTAACCAAGACAAGGCGATGGTGTTGCTCA TGCATTGGCTCAATTTGGATTGCGATAATGGCAGTTTTTTGTATGGGAAG ATGCAGTACCGCCATGGTGGTTGGTTTTTTTAGCAAAATATTGGGAGGGA ATGAGTATTTAGTTTTTGTAGGTAGGGAGGAGCTGCAGTGCCCCTATAGC CCGAGCAGGCCCCATGCGGAAGAAAAAAGTTGAGCCCACGTGAGTGACAC AAGAAGCTACTTCACTCTCCTCAACGCAGCTGCTCCATCTACTCGCCCAT CAGCACATGCATTCAACCAACTTTTGGCCATCCAACACACCAATTGGTTT TTGAAAATGAGTACTCACCCTCATCATTGAAGATGCTCTAGCTGCTCAAG CATTATTCAACACTTTTTATTATTATTATTGTGCAATTCAATGTTCCCTA TAAAACACACGTACTTTAAGTTTTTCACACCACCAATATCATTCACCACA TTTATTTAATTCTACTTAATTTCATAAAATTATTTAATAATTGTTGGTTT TTTTTATTTATTATTTTTGGTAATCTCTCAACATCCTTATGAAAAAATTA TTTAAAAAATATATAAATCAAAGGTTGTTTTCTTTAGTTTAATGTTGTTT TTATTTAAGTCGTTTGTACTCATTTTATGTTCAACGTCTTAATGATATGT GTGTTTGTTGTTCCGGAATATAGTCTTAATTTGATTATTTTGTTGTTAAA ATGATCATAAATGAAAAAACAAAAAAACAAAAACTAACATCATATAAAAT ACATGAACAGAAAATAAGTTAACAAACAACATAGAATAAATCAAAGTACA TCATAAAAATCCAAATATAAAGCCCCCCATCGTGAGAAAGATACCTTTAG AGCCCAGAATATTTCATTGGAGCTCTAAATGAGGCTCTATCCACCATTTT TGTAGCCCCATTTAGAGACTATGATTTGGGATGCCCTAAGGCCATTCCCA ATGATTGGGGCTCTAAAAGAGGTTGA
back to top