CPPCT016, CPPCT016 (genetic_marker) Prunus persica

Marker Overview
NameCPPCT016
AliasCPPCT16-3
CPPCT16
Genbank IDN/A
TypeSSR
SpeciesPrunus persica
Source TypeGenomic DNA
genomic
Repeat Motif(CT)24
PCR Condition94 C 1 min, 94 C 30 sec, 50 C 30 sec, 72 C 1 min. 34 cycles, 72 C 5min
Primer 1CPPCT016.Forward Primer: AATTCCCTATGGAAATTAGACGCATATTATAGGTAGGAAA
Primer 2CPPCT016.primer 1: AATTCCCTATGGAAATTAGACGCATATTATAGGTAGGAAA
Product Length191
Publication[view all]
ContactE. Dirlewanger
Amy Iezzoni
Maria Badenes
Contact
NameDetails
E. Dirlewanger
First name:Elisabeth
Last name:Dirlewanger
Institution:INRA
Address:Unite de Recherche sur les Especes Fruitieres et la Vigne, Centre de Bordeaux, BP 81, 33883 Villenave d Ornon cedex, France
Country:France
Email:dirlewan@bordeaux.inra.fr
Amy Iezzoni
First name:Amy
Last name:Iezzoni
Title:Professor
Institution:Michigan State University
Address:A342 PSSB, East Lansing, MI 48824
Country:USA
Email:iezzoni@msu.edu
Phone:517-355-5191 x1391
Keywords:cherry breeder
Maria Badenes
First name:Maria 
Last name:Badenes
Institution:Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:Spain
Email:badenes_mlu@gva.es
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
Alignment of genetic markers to Prunus persics v2.02019-04-11
GDR Markers Database2004-01-01
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1CPPCT016.primer 1Prunus persicaprimer
Forward PrimerCPPCT016.Forward PrimerPrunus persicaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CPPCT016CPPCT016-1.1Prunus persicamarker_locus
CPPCT016CPPCT016Prunus persicamarker_locus
CPPCT16-3CPPCT16-3Prunus persicamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach_Consensus_map_20181N/A1.1CPPCT016-1.1View
2Prunus-TE-F2G1N/A1.3CPPCT016View
3Sweet Cherry-EFxNY-F1-2008EF1N/A0CPPCT016View
4Peach-CF-F2-20141N/A1.74CPPCT016View
5Flowering Cherry-CYxE750-F1-CY1N/A0CPPCT016View
6Apricot-LL-F2-Lito-2011LG1N/A0CPPCT016View
7Apricot-integrated-Goldrich-2011LG1N/A4.7CPPCT016View
8Prunus-TE-F2-20151N/A0CPPCT016View
9Prunus-TxE-peachV2.0LG1N/A1.3CPPCT016View
10Sweet Cherry-PAxPN-94G1N/A0.9CPPCT016View
11Chokecherry-RCxSC-F1-2014RC XVbN/A95.7CPPCT16-3View
12Chokecherry-RCxSC-F1-2017Cho-15N/A48.4CPPCT16-3View
Alignments
Feature NameTypeLocationAnalysis
Pp01 chromosome Pp01:579332..579689+ Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
Pp01 chromosome Pp01:579332..579689+ Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
scaffold_1 supercontig scaffold_1:579334..579691. Prunus persica Whole Genome v1.0 Assembly & Annotation