Dhn3, Dhn3 (genetic_marker) Prunus dulcis

Marker Overview
NameDhn3
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
SpeciesPrunus dulcis
GermplasmAll in One
PCR Condition95 C 2 min. 95 C 5 sec, 62 10 sec, touchdown 0.5 C each cycle for 10 cycles, 50 cycles. 72 C 2 min.
Primer 1Xeas012F: TTCGGATGAATTCTCTGCAAT
Primer 2Xeas012R: AAATTCCATGAGCCCAACAA
Product Length118
Publication[view all]
ContactW. Shu-Biao
Contact
NameDetails
W. Shu-Biao
First name:Shu-Biao
Last name:Wu
Institution:University of New England
Address:School of Environmental and Rural Science, University of New England, Armidale NSW, Australia
Email:shubiao.wu@une.edu.au
Phone:61 2 6773 2238
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Xeas012FXeas012FPrunus dulcisprimer
Xeas012RXeas012RPrunus dulcisprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
dhn3dhn3Prunus dulcismarker_locus


Germplasm
Stock NameType
All in Onecultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Almond-NL-F1-2010G6N/A42.82dhn3View