EPDCU3122, EPDCU3122 (genetic_marker) Prunus dulcis

Marker Overview
NameEPDCU3122
Genbank IDBU573122
TypeSSR
SpeciesPrunus dulcis
GermplasmNonpareil
Repeat MotifAAC
PCR Condition94 C 2 min, 94 C 25 sec, 57 C 20 sec, 72 C 20 sec. 35 cycles, 72 C 5 min
Primer 1EPDCU3122.F primer: AGCGGAGTGTACAGCAAGGT
Primer 2EPDCU3122.R primer: TATGTTGTTTCCGGCATTGA
Primer 3EPDCU3122.forward primer: AGCGGAGTGTACAGCAAGGT
Primer 4EPDCU3122.revers primer: TATGTTGTTTCCGGCATTGA
Product Length177
Publication[view all]
ContactW. Howad
Ignazio Verde
Contact
NameDetails
W. Howad
First name:Werner
Last name:Howad
Institution:IRTA
Address:Institut de Recerca I Tecnologia Agroalimentaries (IRTA), Departament de Genetica Vegetal, Carretera de Cabrils s/n, 08348 Cabrils, Spain
Email:werner.howad@irta.es
Ignazio Verde
First name:Ignazio
Last name:Verde
Title:researcher
Institution:Istituto Sperimentale per la Frutticoltura (CRA)
Address:Via di Fioranello 52, Ciampino Aeroporto, 00040 Rome, Italy
Country:Italy
Email:ignazio.verde@entecra.it
Phone:(+39) 0679348183
Fax:(+39) 0679341630
Keywords:Peach
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
Alignment of genetic markers to Prunus persics v2.02019-04-11
GDR Markers Database2004-01-01
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerEPDCU3122.forward primerPrunus dulcisprimer
revers primerEPDCU3122.revers primerPrunus dulcisprimer
R primerEPDCU3122.R primerPrunus dulcisprimer
F primerEPDCU3122.F primerPrunus dulcisprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
EPDCU3122EPDCU3122-6.4Prunus dulcismarker_locus
EPDCU3122EPDCU3122Prunus dulcismarker_locus


Germplasm
Stock NameType
Nonpareilcultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach_Consensus_map_20181N/A6.4EPDCU3122-6.4View
2Prunus-TE-F2-20151N/A1.2EPDCU3122View
3Prunus-TE-BC1-T1EG1_T1EN/A0.8EPDCU3122View
4Prunus-TxE-peachV2.0LG1N/A2.5EPDCU3122View
Alignments
Feature NameTypeLocationAnalysis
Pp01 chromosome Pp01:1207006..1207675+ Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
scaffold_1 supercontig scaffold_1:1207146..1207815. Prunus persica Whole Genome v1.0 Assembly & Annotation